Incidental Mutation 'R0138:Bap1'
ID22128
Institutional Source Beutler Lab
Gene Symbol Bap1
Ensembl Gene ENSMUSG00000021901
Gene NameBrca1 associated protein 1
Synonyms2300006C11Rik
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location31251450-31259944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31256724 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 31 (Y31H)
Ref Sequence ENSEMBL: ENSMUSP00000139903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000048603] [ENSMUST00000187156] [ENSMUST00000188453]
Predicted Effect probably damaging
Transcript: ENSMUST00000022458
AA Change: Y394H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901
AA Change: Y394H

DomainStartEndE-ValueType
Pfam:Peptidase_C12 5 215 3e-70 PFAM
low complexity region 282 293 N/A INTRINSIC
low complexity region 396 407 N/A INTRINSIC
low complexity region 577 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048603
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185987
Predicted Effect probably damaging
Transcript: ENSMUST00000187156
AA Change: Y31H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139903
Gene: ENSMUSG00000021901
AA Change: Y31H

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188453
SMART Domains Protein: ENSMUSP00000139824
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
Pfam:Peptidase_C12 4 137 3.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190788
Meta Mutation Damage Score 0.0745 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous deletion of this gene causes delayed embryonic growth and complete lethality during organogenesis. Systemic or hematopoietic-restricted deletion in adults recapitulates features of myelodysplastic syndrome. Heterozygotes show increased incidence of asbestos-induced malignant mesothelioma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Bap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Bap1 APN 14 31253569 missense probably damaging 0.97
IGL02110:Bap1 APN 14 31257414 missense probably damaging 0.97
IGL02740:Bap1 APN 14 31256772 missense possibly damaging 0.94
IGL02937:Bap1 APN 14 31258327 missense probably benign 0.07
R1221:Bap1 UTSW 14 31257651 missense probably damaging 1.00
R2131:Bap1 UTSW 14 31258331 nonsense probably null
R2204:Bap1 UTSW 14 31256701 missense probably benign 0.10
R3781:Bap1 UTSW 14 31257618 missense possibly damaging 0.71
R4882:Bap1 UTSW 14 31251721 unclassified probably benign
R4897:Bap1 UTSW 14 31258445 unclassified probably benign
R5249:Bap1 UTSW 14 31257286 unclassified probably benign
R6548:Bap1 UTSW 14 31256225 missense probably benign 0.01
R6990:Bap1 UTSW 14 31255651 missense probably benign
R7203:Bap1 UTSW 14 31254169 missense probably damaging 1.00
R7212:Bap1 UTSW 14 31251623 missense probably damaging 0.99
R7414:Bap1 UTSW 14 31253615 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGAAGCACTTCGCACAGCTAAGAG -3'
(R):5'- TTTGAGGTCGGGCTGAAAGATCAC -3'

Sequencing Primer
(F):5'- ACAGCTAAGAGCCTAGTTATCTTCC -3'
(R):5'- ACATGGTAAGATGTTTACCTCCC -3'
Posted On2013-04-12