Incidental Mutation 'R1973:Chat'
ID221296
Institutional Source Beutler Lab
Gene Symbol Chat
Ensembl Gene ENSMUSG00000021919
Gene Namecholine acetyltransferase
SynonymsB230380D24Rik
MMRRC Submission 039986-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R1973 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32408203-32465989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32424191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 342 (V342I)
Ref Sequence ENSEMBL: ENSMUSP00000070865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070125]
Predicted Effect probably benign
Transcript: ENSMUST00000070125
AA Change: V342I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000070865
Gene: ENSMUSG00000021919
AA Change: V342I

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 24 612 5.5e-190 PFAM
Meta Mutation Damage Score 0.0815 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutation of this gene results in hyperinnervation of motor neurons, abnormal morphology and patterning of neuromuscular synapses, and perinatal lethality. Mutant fetuses at E18.5 exhibit a hunched position, reduced body length, and carpoptosis(drop wrist). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,812,746 I143L probably benign Het
Acp7 T A 7: 28,607,989 D481V probably damaging Het
AI597479 T A 1: 43,111,126 I132K probably benign Het
Anxa13 T C 15: 58,356,181 noncoding transcript Het
Brca1 A T 11: 101,526,403 C302S probably benign Het
Brd8 T A 18: 34,608,013 D420V probably damaging Het
Cacna1g A T 11: 94,459,777 V414E possibly damaging Het
Ccdc142 T A 6: 83,102,563 C294S probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chd6 A G 2: 160,966,387 S1636P probably damaging Het
Clec4a1 A G 6: 122,924,834 probably null Het
Col6a3 A T 1: 90,804,175 I1452N probably damaging Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Dscr3 T C 16: 94,501,546 N267S probably damaging Het
Efl1 T C 7: 82,762,877 S825P probably damaging Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Faxc G A 4: 21,993,405 E350K probably benign Het
Frem2 T A 3: 53,652,232 Y1618F probably benign Het
Fubp3 A G 2: 31,603,286 T6A probably benign Het
Gm5814 A T 17: 47,410,549 M63L probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Kcnh3 T C 15: 99,229,400 V359A probably damaging Het
Kit G A 5: 75,615,442 A295T probably damaging Het
Krt77 G T 15: 101,861,244 A397E probably damaging Het
Mis18bp1 G C 12: 65,149,076 S638* probably null Het
Neurl4 C T 11: 69,909,292 P1091S probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nos1 A G 5: 117,936,426 T1046A possibly damaging Het
Nsfl1c G T 2: 151,505,414 S202I probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Nwd1 T C 8: 72,704,962 V1195A possibly damaging Het
Olfr243 T A 7: 103,716,597 M1K probably null Het
Olfr370 T C 8: 83,541,792 V216A probably benign Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Olfr919 A G 9: 38,697,868 V170A probably damaging Het
Pclo G T 5: 14,676,059 probably null Het
Pnpla7 A G 2: 25,016,617 D664G probably damaging Het
Prl8a1 G A 13: 27,576,934 T105I probably benign Het
Ptger1 C A 8: 83,669,454 T380K probably benign Het
Ptk7 G A 17: 46,586,807 Q282* probably null Het
Ptpn18 G T 1: 34,463,109 D45Y probably damaging Het
Rab11fip3 T C 17: 26,024,391 D589G probably damaging Het
Rara A G 11: 98,971,670 N299S possibly damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Rslcan18 T C 13: 67,108,023 probably benign Het
Rtel1 A G 2: 181,351,626 Y731C probably benign Het
Sec16a A T 2: 26,426,489 S1666R probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc10a7 T A 8: 78,697,333 probably null Het
Slc22a7 A G 17: 46,437,090 V214A probably damaging Het
Slc26a8 T C 17: 28,663,605 I249V probably benign Het
Slc38a4 T C 15: 96,999,597 K446E probably benign Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spef2 T G 15: 9,663,066 *876C probably null Het
Spink11 A G 18: 44,196,138 C14R unknown Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tnfaip3 T C 10: 19,004,504 N605S probably damaging Het
Trpc1 A G 9: 95,723,255 M283T probably benign Het
Ttn A G 2: 76,714,362 S32799P probably damaging Het
Ttn A G 2: 76,720,099 I31613T probably damaging Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Usp32 G T 11: 85,103,931 L52I probably benign Het
Usp33 A G 3: 152,360,286 T68A possibly damaging Het
Vmn1r7 A G 6: 57,025,026 F83S probably benign Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr43 A G 17: 71,640,240 N364D probably benign Het
Zdbf2 C A 1: 63,309,701 P2413Q unknown Het
Other mutations in Chat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Chat APN 14 32449023 missense probably damaging 0.98
IGL01618:Chat APN 14 32446892 unclassified probably null
IGL02192:Chat APN 14 32423322 missense possibly damaging 0.94
IGL02418:Chat APN 14 32446949 missense possibly damaging 0.74
IGL02851:Chat APN 14 32458613 missense probably benign
IGL02966:Chat APN 14 32448946 missense probably damaging 1.00
IGL03401:Chat APN 14 32452569 missense probably damaging 1.00
R0511:Chat UTSW 14 32409019 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1729:Chat UTSW 14 32446795 missense probably damaging 1.00
R1782:Chat UTSW 14 32408987 missense probably damaging 1.00
R1972:Chat UTSW 14 32424191 missense probably benign 0.03
R2061:Chat UTSW 14 32446873 missense probably benign 0.00
R2270:Chat UTSW 14 32454581 missense probably damaging 0.99
R4012:Chat UTSW 14 32423312 missense possibly damaging 0.56
R4601:Chat UTSW 14 32424155 missense probably benign 0.00
R4620:Chat UTSW 14 32453818 missense probably damaging 1.00
R4760:Chat UTSW 14 32453737 missense probably benign
R4885:Chat UTSW 14 32454610 missense probably damaging 1.00
R4899:Chat UTSW 14 32448977 missense possibly damaging 0.80
R4940:Chat UTSW 14 32419105 missense probably damaging 1.00
R4960:Chat UTSW 14 32420814 missense possibly damaging 0.86
R5094:Chat UTSW 14 32408939 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6621:Chat UTSW 14 32419013 missense probably damaging 0.97
R6648:Chat UTSW 14 32454694 missense probably benign 0.17
R6980:Chat UTSW 14 32424154 missense probably benign 0.15
R7203:Chat UTSW 14 32419057 missense probably damaging 1.00
R7336:Chat UTSW 14 32423256 splice site probably null
R7530:Chat UTSW 14 32408958 nonsense probably null
X0014:Chat UTSW 14 32446933 missense probably benign 0.01
X0066:Chat UTSW 14 32453831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCATAACGCTCATTTTGC -3'
(R):5'- GAGGCTTCCATACTGTTGGG -3'

Sequencing Primer
(F):5'- ATAACGCTCATTTTGCAGTCTTTG -3'
(R):5'- GGTACCTACAGCCATCTGCAG -3'
Posted On2014-08-25