Incidental Mutation 'R2031:Ms4a18'
ID 221304
Institutional Source Beutler Lab
Gene Symbol Ms4a18
Ensembl Gene ENSMUSG00000094584
Gene Name membrane-spanning 4-domains, subfamily A, member 18
Synonyms 5033428B15Rik
MMRRC Submission 040038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R2031 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 10997025-11018031 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11013650 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 27 (S27P)
Ref Sequence ENSEMBL: ENSMUSP00000136529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177684]
AlphaFold J3QN01
Predicted Effect probably benign
Transcript: ENSMUST00000177684
AA Change: S27P

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136529
Gene: ENSMUSG00000094584
AA Change: S27P

DomainStartEndE-ValueType
Pfam:CD20 152 299 1.2e-18 PFAM
low complexity region 300 324 N/A INTRINSIC
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Ms4a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0556:Ms4a18 UTSW 19 11013701 missense probably damaging 0.98
R1987:Ms4a18 UTSW 19 11013655 missense probably damaging 1.00
R2137:Ms4a18 UTSW 19 10997331 missense possibly damaging 0.86
R2138:Ms4a18 UTSW 19 10997331 missense possibly damaging 0.86
R2139:Ms4a18 UTSW 19 10997331 missense possibly damaging 0.86
R2192:Ms4a18 UTSW 19 11013665 missense probably benign 0.09
R2211:Ms4a18 UTSW 19 10997305 missense probably benign 0.33
R3739:Ms4a18 UTSW 19 11011499 missense probably damaging 1.00
R5586:Ms4a18 UTSW 19 11013674 missense probably benign 0.00
R6102:Ms4a18 UTSW 19 11013523 missense probably benign
R7091:Ms4a18 UTSW 19 11008728 missense probably damaging 0.98
R7316:Ms4a18 UTSW 19 11001996 missense probably damaging 1.00
R8162:Ms4a18 UTSW 19 11013707 missense probably benign 0.00
R8854:Ms4a18 UTSW 19 11013523 missense probably benign
R9098:Ms4a18 UTSW 19 11013377 missense
R9157:Ms4a18 UTSW 19 11011440 missense probably damaging 0.98
R9313:Ms4a18 UTSW 19 11011440 missense probably damaging 0.98
R9583:Ms4a18 UTSW 19 10997350 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACTTCTGGTGAGTACTGGATTACTC -3'
(R):5'- AGGCTTGCATTTTAGTGAAGAC -3'

Sequencing Primer
(F):5'- GCCAGCCATTCCTGCTGAATAC -3'
(R):5'- GCTTGCATTTTAGTGAAGACAATAAC -3'
Posted On 2014-08-25