Incidental Mutation 'R2031:Cpeb3'
ID221310
Institutional Source Beutler Lab
Gene Symbol Cpeb3
Ensembl Gene ENSMUSG00000039652
Gene Namecytoplasmic polyadenylation element binding protein 3
Synonyms4831444O18Rik
MMRRC Submission 040038-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R2031 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location37021291-37208601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37044679 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 589 (R589H)
Ref Sequence ENSEMBL: ENSMUSP00000116172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079754] [ENSMUST00000123727] [ENSMUST00000124158] [ENSMUST00000126188] [ENSMUST00000132580] [ENSMUST00000136286] [ENSMUST00000154376]
Predicted Effect probably damaging
Transcript: ENSMUST00000079754
AA Change: R589H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078690
Gene: ENSMUSG00000039652
AA Change: R589H

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000123727
AA Change: R558H

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121987
Gene: ENSMUSG00000039652
AA Change: R558H

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 429 501 2.01e-5 SMART
RRM 537 610 1e-2 SMART
PDB:2M13|A 611 676 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000124158
AA Change: R288H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115656
Gene: ENSMUSG00000039652
AA Change: R288H

DomainStartEndE-ValueType
RRM 159 231 2.01e-5 SMART
RRM 267 340 1e-2 SMART
PDB:2M13|A 341 406 6e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000126188
AA Change: R566H

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120416
Gene: ENSMUSG00000039652
AA Change: R566H

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 2.01e-5 SMART
RRM 545 618 1e-2 SMART
PDB:2M13|A 619 684 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000132580
AA Change: R589H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118723
Gene: ENSMUSG00000039652
AA Change: R589H

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000136286
AA Change: R572H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116309
Gene: ENSMUSG00000039652
AA Change: R572H

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 443 515 2.01e-5 SMART
RRM 551 624 1e-2 SMART
PDB:2M13|A 625 690 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000154376
AA Change: R589H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116172
Gene: ENSMUSG00000039652
AA Change: R589H

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, increased anxiety-related response, enhanced contextual conditioning behavior, abnormal spatial reference memory, hypoactivity and abnormal hippocampus pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Cpeb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Cpeb3 APN 19 37054295 missense probably damaging 1.00
IGL01402:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01404:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01702:Cpeb3 APN 19 37126382 missense possibly damaging 0.85
IGL01811:Cpeb3 APN 19 37044608 missense probably damaging 1.00
IGL03036:Cpeb3 APN 19 37024948 missense probably damaging 1.00
R0580:Cpeb3 UTSW 19 37174035 missense probably benign 0.02
R1463:Cpeb3 UTSW 19 37139100 missense probably benign 0.08
R1572:Cpeb3 UTSW 19 37139082 missense probably benign 0.38
R1914:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R1915:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R4296:Cpeb3 UTSW 19 37173989 missense possibly damaging 0.90
R4528:Cpeb3 UTSW 19 37139088 missense possibly damaging 0.85
R4607:Cpeb3 UTSW 19 37174839 missense possibly damaging 0.82
R4909:Cpeb3 UTSW 19 37174659 missense probably damaging 1.00
R4909:Cpeb3 UTSW 19 37174233 missense possibly damaging 0.63
R5240:Cpeb3 UTSW 19 37174515 missense probably damaging 0.99
R5985:Cpeb3 UTSW 19 37087552 missense probably damaging 1.00
R6179:Cpeb3 UTSW 19 37088453 missense probably damaging 1.00
R6309:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R6768:Cpeb3 UTSW 19 37025032 missense possibly damaging 0.92
R6787:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R7102:Cpeb3 UTSW 19 37174719 missense probably benign
R7194:Cpeb3 UTSW 19 37174752 missense probably benign
R7422:Cpeb3 UTSW 19 37174500 missense probably benign 0.13
R7594:Cpeb3 UTSW 19 37174151 missense possibly damaging 0.70
R7630:Cpeb3 UTSW 19 37054293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATACTGTCTGGCCCAGG -3'
(R):5'- GTGGCTCTTCGATCAGAATTG -3'

Sequencing Primer
(F):5'- GGGCTGCACAAATAAACTTCATTTCC -3'
(R):5'- GCTCTTCGATCAGAATTGGAAGAC -3'
Posted On2014-08-25