Incidental Mutation 'R2032:Dolpp1'
ID221322
Institutional Source Beutler Lab
Gene Symbol Dolpp1
Ensembl Gene ENSMUSG00000026856
Gene Namedolichyl pyrophosphate phosphatase 1
Synonyms0610011H20Rik, LSFR2
MMRRC Submission 040039-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R2032 (G1)
Quality Score216
Status Validated
Chromosome2
Chromosomal Location30392254-30400529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30392441 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2 (A2V)
Ref Sequence ENSEMBL: ENSMUSP00000028209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028209] [ENSMUST00000113612] [ENSMUST00000123202]
Predicted Effect probably damaging
Transcript: ENSMUST00000028209
AA Change: A2V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028209
Gene: ENSMUSG00000026856
AA Change: A2V

DomainStartEndE-ValueType
acidPPc 59 180 1.31e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113612
AA Change: A2V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109242
Gene: ENSMUSG00000026856
AA Change: A2V

DomainStartEndE-ValueType
Pfam:PAP2 58 165 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123202
SMART Domains Protein: ENSMUSP00000119478
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
Pfam:PAP2 1 90 8.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133991
Predicted Effect unknown
Transcript: ENSMUST00000137248
AA Change: A1V
SMART Domains Protein: ENSMUSP00000116276
Gene: ENSMUSG00000026856
AA Change: A1V

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 71 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152303
Predicted Effect probably benign
Transcript: ENSMUST00000155196
SMART Domains Protein: ENSMUSP00000115602
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 69 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156984
Meta Mutation Damage Score 0.5296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A similar gene has been characterized in mice and encodes dolichyl pyrophosphate (Dol-P-P) phosphatase. This protein dephosphorylates dolichyl pyrophosphate so that it may be re-utilized as a glycosyl carrier lipid by the oligosaccharyltransferase multisubunit complex in the ER. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,243,052 G674E probably damaging Het
Abca3 G A 17: 24,366,082 probably benign Het
Abca7 C T 10: 80,008,237 T1359M probably damaging Het
Acox2 A G 14: 8,246,400 S464P probably benign Het
Adgrf1 C T 17: 43,311,275 T801I probably damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Akap12 C A 10: 4,356,673 A1161D possibly damaging Het
Ankrd36 T A 11: 5,628,616 V635D possibly damaging Het
Ankrd44 C T 1: 54,723,009 probably null Het
Atl2 A G 17: 79,895,944 V28A probably benign Het
Atxn3 A T 12: 101,942,194 L133* probably null Het
Bmp2 T C 2: 133,561,296 S256P probably benign Het
Ccdc138 T A 10: 58,513,162 Y177N possibly damaging Het
Cep164 C T 9: 45,771,600 V931M probably damaging Het
CK137956 T C 4: 127,945,276 T450A probably benign Het
Col23a1 G A 11: 51,560,008 G215D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd6a T C 14: 26,604,749 M5T probably benign Het
Dnajc6 T G 4: 101,614,238 I284S probably benign Het
Eml2 C T 7: 19,202,555 T711I probably benign Het
Evi5l T C 8: 4,210,622 D1065G probably damaging Het
Fam110b G T 4: 5,799,460 A293S probably benign Het
Fap A G 2: 62,542,237 V266A probably benign Het
Fgf10 A T 13: 118,715,595 Y71F probably damaging Het
Gm3443 G T 19: 21,555,800 G43C probably damaging Het
Gm4788 T A 1: 139,733,255 probably benign Het
Gm6583 G A 5: 112,355,112 T242I possibly damaging Het
Gm7257 T C 9: 36,432,899 probably null Het
Gm8251 C A 1: 44,061,740 C66F possibly damaging Het
Gpr146 T C 5: 139,379,147 probably benign Het
Hif3a A T 7: 17,051,179 L172H probably damaging Het
Mas1 T C 17: 12,842,570 probably benign Het
Nlrp5 G A 7: 23,421,512 R717Q probably damaging Het
Nop14 A G 5: 34,659,939 V36A possibly damaging Het
Olfr1417 C T 19: 11,828,300 C242Y probably damaging Het
Olfr33 A T 7: 102,713,876 I179N probably benign Het
Olfr57 T A 10: 79,035,329 F178I possibly damaging Het
Parp4 T A 14: 56,629,096 I1039K possibly damaging Het
Pold2 A T 11: 5,876,757 I59N probably benign Het
Prr36 T C 8: 4,214,304 probably benign Het
Pyroxd2 T C 19: 42,727,649 probably benign Het
Recql C T 6: 142,367,283 G403R probably damaging Het
Serpina3m T A 12: 104,389,669 D198E probably benign Het
Sik2 A T 9: 50,995,647 Y93N probably damaging Het
Slc27a3 C T 3: 90,387,397 R389H probably damaging Het
Slc29a1 A T 17: 45,586,109 M417K probably damaging Het
Syt13 A G 2: 92,953,401 K339E probably damaging Het
Tmem237 A T 1: 59,109,106 H163Q probably benign Het
Tram2 C T 1: 21,003,956 G253R probably null Het
Trpv1 A G 11: 73,238,385 T43A probably benign Het
Ugt2b34 A G 5: 86,891,272 I510T probably damaging Het
Vmn1r224 C A 17: 20,419,396 D78E probably benign Het
Vmn1r78 A T 7: 12,153,283 I274L probably benign Het
Wdfy4 C T 14: 33,146,989 V361I probably benign Het
Zpbp2 A T 11: 98,554,708 K165N probably damaging Het
Other mutations in Dolpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Dolpp1 APN 2 30397095 missense probably damaging 1.00
IGL02896:Dolpp1 APN 2 30396230 missense probably damaging 0.99
R1321:Dolpp1 UTSW 2 30395736 missense possibly damaging 0.83
R3722:Dolpp1 UTSW 2 30397488 missense probably damaging 0.98
R4407:Dolpp1 UTSW 2 30396452 missense possibly damaging 0.91
R5417:Dolpp1 UTSW 2 30396237 missense probably damaging 1.00
R5895:Dolpp1 UTSW 2 30395646 splice site probably benign
R6270:Dolpp1 UTSW 2 30392269 unclassified probably benign
R7818:Dolpp1 UTSW 2 30396491 missense probably benign 0.24
R8108:Dolpp1 UTSW 2 30396246 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GATTGGACACTGGCAAAGCTG -3'
(R):5'- TGTTTGACAGTTCCCACCG -3'

Sequencing Primer
(F):5'- GCAAAGCTGCGCGAGTC -3'
(R):5'- ACAGTTCCCACCGCGGTTC -3'
Posted On2014-08-25