Incidental Mutation 'R2032:Dnajc6'
ID221333
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
MMRRC Submission 040039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2032 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101614238 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 284 (I284S)
Ref Sequence ENSEMBL: ENSMUSP00000102543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933] [ENSMUST00000149047]
Predicted Effect probably benign
Transcript: ENSMUST00000038207
AA Change: I322S

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: I322S

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094953
AA Change: I284S

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: I284S

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106929
AA Change: I284S

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: I284S

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106930
AA Change: I284S

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: I284S

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106933
AA Change: I352S

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: I352S

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149047
SMART Domains Protein: ENSMUSP00000119542
Gene: ENSMUSG00000028528

DomainStartEndE-ValueType
PDB:3N0A|A 30 194 1e-118 PDB
SCOP:d1d5ra2 50 187 2e-17 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,243,052 G674E probably damaging Het
Abca3 G A 17: 24,366,082 probably benign Het
Abca7 C T 10: 80,008,237 T1359M probably damaging Het
Acox2 A G 14: 8,246,400 S464P probably benign Het
Adgrf1 C T 17: 43,311,275 T801I probably damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Akap12 C A 10: 4,356,673 A1161D possibly damaging Het
Ankrd36 T A 11: 5,628,616 V635D possibly damaging Het
Ankrd44 C T 1: 54,723,009 probably null Het
Atl2 A G 17: 79,895,944 V28A probably benign Het
Atxn3 A T 12: 101,942,194 L133* probably null Het
Bmp2 T C 2: 133,561,296 S256P probably benign Het
Ccdc138 T A 10: 58,513,162 Y177N possibly damaging Het
Cep164 C T 9: 45,771,600 V931M probably damaging Het
CK137956 T C 4: 127,945,276 T450A probably benign Het
Col23a1 G A 11: 51,560,008 G215D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd6a T C 14: 26,604,749 M5T probably benign Het
Dolpp1 C T 2: 30,392,441 A2V probably damaging Het
Eml2 C T 7: 19,202,555 T711I probably benign Het
Evi5l T C 8: 4,210,622 D1065G probably damaging Het
Fam110b G T 4: 5,799,460 A293S probably benign Het
Fap A G 2: 62,542,237 V266A probably benign Het
Fgf10 A T 13: 118,715,595 Y71F probably damaging Het
Gm3443 G T 19: 21,555,800 G43C probably damaging Het
Gm4788 T A 1: 139,733,255 probably benign Het
Gm6583 G A 5: 112,355,112 T242I possibly damaging Het
Gm7257 T C 9: 36,432,899 probably null Het
Gm8251 C A 1: 44,061,740 C66F possibly damaging Het
Gpr146 T C 5: 139,379,147 probably benign Het
Hif3a A T 7: 17,051,179 L172H probably damaging Het
Mas1 T C 17: 12,842,570 probably benign Het
Nlrp5 G A 7: 23,421,512 R717Q probably damaging Het
Nop14 A G 5: 34,659,939 V36A possibly damaging Het
Olfr1417 C T 19: 11,828,300 C242Y probably damaging Het
Olfr33 A T 7: 102,713,876 I179N probably benign Het
Olfr57 T A 10: 79,035,329 F178I possibly damaging Het
Parp4 T A 14: 56,629,096 I1039K possibly damaging Het
Pold2 A T 11: 5,876,757 I59N probably benign Het
Prr36 T C 8: 4,214,304 probably benign Het
Pyroxd2 T C 19: 42,727,649 probably benign Het
Recql C T 6: 142,367,283 G403R probably damaging Het
Serpina3m T A 12: 104,389,669 D198E probably benign Het
Sik2 A T 9: 50,995,647 Y93N probably damaging Het
Slc27a3 C T 3: 90,387,397 R389H probably damaging Het
Slc29a1 A T 17: 45,586,109 M417K probably damaging Het
Syt13 A G 2: 92,953,401 K339E probably damaging Het
Tmem237 A T 1: 59,109,106 H163Q probably benign Het
Tram2 C T 1: 21,003,956 G253R probably null Het
Trpv1 A G 11: 73,238,385 T43A probably benign Het
Ugt2b34 A G 5: 86,891,272 I510T probably damaging Het
Vmn1r224 C A 17: 20,419,396 D78E probably benign Het
Vmn1r78 A T 7: 12,153,283 I274L probably benign Het
Wdfy4 C T 14: 33,146,989 V361I probably benign Het
Zpbp2 A T 11: 98,554,708 K165N probably damaging Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101635116 missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101616577 missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101635065 nonsense probably null
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101612945 missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101597803 missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101639372 missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101606611 missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101597926 missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101640491 missense probably damaging 1.00
R7652:Dnajc6 UTSW 4 101606677 missense probably damaging 0.98
R7789:Dnajc6 UTSW 4 101618532 missense possibly damaging 0.82
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATACCGGCATCATTCC -3'
(R):5'- TGGACATCAACAAGCCATCAGG -3'

Sequencing Primer
(F):5'- AGGAAGGAGCTTCTATGTCTAAGTC -3'
(R):5'- AGGCTCTTTCTCACTCCAAAC -3'
Posted On2014-08-25