Incidental Mutation 'R2032:CK137956'
ID221337
Institutional Source Beutler Lab
Gene Symbol CK137956
Ensembl Gene ENSMUSG00000028813
Gene NamecDNA sequence CK137956
Synonyms
MMRRC Submission 040039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2032 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location127927592-127970951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127945276 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 450 (T450A)
Ref Sequence ENSEMBL: ENSMUSP00000030614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030614]
Predicted Effect probably benign
Transcript: ENSMUST00000030614
AA Change: T450A

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030614
Gene: ENSMUSG00000028813
AA Change: T450A

DomainStartEndE-ValueType
Pfam:DUF4688 197 596 3.8e-249 PFAM
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,243,052 G674E probably damaging Het
Abca3 G A 17: 24,366,082 probably benign Het
Abca7 C T 10: 80,008,237 T1359M probably damaging Het
Acox2 A G 14: 8,246,400 S464P probably benign Het
Adgrf1 C T 17: 43,311,275 T801I probably damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Akap12 C A 10: 4,356,673 A1161D possibly damaging Het
Ankrd36 T A 11: 5,628,616 V635D possibly damaging Het
Ankrd44 C T 1: 54,723,009 probably null Het
Atl2 A G 17: 79,895,944 V28A probably benign Het
Atxn3 A T 12: 101,942,194 L133* probably null Het
Bmp2 T C 2: 133,561,296 S256P probably benign Het
Ccdc138 T A 10: 58,513,162 Y177N possibly damaging Het
Cep164 C T 9: 45,771,600 V931M probably damaging Het
Col23a1 G A 11: 51,560,008 G215D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd6a T C 14: 26,604,749 M5T probably benign Het
Dnajc6 T G 4: 101,614,238 I284S probably benign Het
Dolpp1 C T 2: 30,392,441 A2V probably damaging Het
Eml2 C T 7: 19,202,555 T711I probably benign Het
Evi5l T C 8: 4,210,622 D1065G probably damaging Het
Fam110b G T 4: 5,799,460 A293S probably benign Het
Fap A G 2: 62,542,237 V266A probably benign Het
Fgf10 A T 13: 118,715,595 Y71F probably damaging Het
Gm3443 G T 19: 21,555,800 G43C probably damaging Het
Gm4788 T A 1: 139,733,255 probably benign Het
Gm6583 G A 5: 112,355,112 T242I possibly damaging Het
Gm7257 T C 9: 36,432,899 probably null Het
Gm8251 C A 1: 44,061,740 C66F possibly damaging Het
Gpr146 T C 5: 139,379,147 probably benign Het
Hif3a A T 7: 17,051,179 L172H probably damaging Het
Mas1 T C 17: 12,842,570 probably benign Het
Nlrp5 G A 7: 23,421,512 R717Q probably damaging Het
Nop14 A G 5: 34,659,939 V36A possibly damaging Het
Olfr1417 C T 19: 11,828,300 C242Y probably damaging Het
Olfr33 A T 7: 102,713,876 I179N probably benign Het
Olfr57 T A 10: 79,035,329 F178I possibly damaging Het
Parp4 T A 14: 56,629,096 I1039K possibly damaging Het
Pold2 A T 11: 5,876,757 I59N probably benign Het
Prr36 T C 8: 4,214,304 probably benign Het
Pyroxd2 T C 19: 42,727,649 probably benign Het
Recql C T 6: 142,367,283 G403R probably damaging Het
Serpina3m T A 12: 104,389,669 D198E probably benign Het
Sik2 A T 9: 50,995,647 Y93N probably damaging Het
Slc27a3 C T 3: 90,387,397 R389H probably damaging Het
Slc29a1 A T 17: 45,586,109 M417K probably damaging Het
Syt13 A G 2: 92,953,401 K339E probably damaging Het
Tmem237 A T 1: 59,109,106 H163Q probably benign Het
Tram2 C T 1: 21,003,956 G253R probably null Het
Trpv1 A G 11: 73,238,385 T43A probably benign Het
Ugt2b34 A G 5: 86,891,272 I510T probably damaging Het
Vmn1r224 C A 17: 20,419,396 D78E probably benign Het
Vmn1r78 A T 7: 12,153,283 I274L probably benign Het
Wdfy4 C T 14: 33,146,989 V361I probably benign Het
Zpbp2 A T 11: 98,554,708 K165N probably damaging Het
Other mutations in CK137956
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:CK137956 APN 4 127935850 missense probably benign
IGL01365:CK137956 APN 4 127951342 missense probably benign 0.01
IGL01563:CK137956 APN 4 127970635 missense possibly damaging 0.94
IGL01834:CK137956 APN 4 127946649 missense probably damaging 1.00
R0117:CK137956 UTSW 4 127946792 missense possibly damaging 0.63
R0456:CK137956 UTSW 4 127945307 missense probably damaging 0.99
R0492:CK137956 UTSW 4 127951300 missense probably benign 0.03
R1793:CK137956 UTSW 4 127951449 missense probably benign
R1869:CK137956 UTSW 4 127970534 missense possibly damaging 0.92
R1932:CK137956 UTSW 4 127946858 missense possibly damaging 0.89
R2011:CK137956 UTSW 4 127951036 missense probably benign 0.25
R2030:CK137956 UTSW 4 127951387 missense probably benign 0.23
R2135:CK137956 UTSW 4 127951640 splice site probably benign
R2994:CK137956 UTSW 4 127951507 missense probably benign 0.03
R3608:CK137956 UTSW 4 127951326 missense probably damaging 1.00
R3895:CK137956 UTSW 4 127946648 missense probably benign 0.01
R4165:CK137956 UTSW 4 127970729 missense possibly damaging 0.83
R5610:CK137956 UTSW 4 127946647 critical splice donor site probably null
R6861:CK137956 UTSW 4 127970726 missense probably damaging 0.98
R7149:CK137956 UTSW 4 127970833 start codon destroyed probably null 0.53
R8132:CK137956 UTSW 4 127951282 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGACACACAGGTTGTCTACTC -3'
(R):5'- ACCTGACCCCTGAGAATCTG -3'

Sequencing Primer
(F):5'- CCTCATATGAGCTATGGTTAGAGATG -3'
(R):5'- CTGAGAATCTGTATTCCCTGGTCG -3'
Posted On2014-08-25