Incidental Mutation 'R0138:Dppa4'
ID22135
Institutional Source Beutler Lab
Gene Symbol Dppa4
Ensembl Gene ENSMUSG00000058550
Gene Namedevelopmental pluripotency associated 4
Synonyms2410091M23Rik, ECAT15-1
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location48283733-48294237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48291062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 85 (T85S)
Ref Sequence ENSEMBL: ENSMUSP00000093748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050705] [ENSMUST00000096045]
Predicted Effect probably benign
Transcript: ENSMUST00000050705
AA Change: T85S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093748
Gene: ENSMUSG00000058550
AA Change: T85S

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 125 142 N/A INTRINSIC
Pfam:DCR 169 236 1.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096045
AA Change: T137S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093749
Gene: ENSMUSG00000058550
AA Change: T137S

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Blast:SAP 81 115 3e-9 BLAST
Pfam:Dppa2_A 123 158 1.2e-3 PFAM
Pfam:Dppa2_A 173 219 1.1e-9 PFAM
Pfam:DCR 221 287 1.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231359
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal and postnatal lethality, abnormal lung morphology, skeletal defects, and a maternal effect on female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Dppa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Dppa4 APN 16 48291083 missense possibly damaging 0.78
IGL02527:Dppa4 APN 16 48289093 missense possibly damaging 0.93
R0346:Dppa4 UTSW 16 48289324 splice site probably benign
R1216:Dppa4 UTSW 16 48292980 missense possibly damaging 0.91
R1453:Dppa4 UTSW 16 48291233 missense probably damaging 1.00
R1852:Dppa4 UTSW 16 48287884 missense probably damaging 0.99
R4452:Dppa4 UTSW 16 48289336 missense probably benign 0.38
R5133:Dppa4 UTSW 16 48292971 missense probably benign 0.18
R5616:Dppa4 UTSW 16 48291030 missense probably damaging 1.00
R5665:Dppa4 UTSW 16 48291015 missense probably benign
R5947:Dppa4 UTSW 16 48291108 missense possibly damaging 0.78
R5993:Dppa4 UTSW 16 48289346 nonsense probably null
R6018:Dppa4 UTSW 16 48289127 nonsense probably null
R6701:Dppa4 UTSW 16 48291311 nonsense probably null
R6719:Dppa4 UTSW 16 48287884 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACCATTCAGGTGGTTGGAAGAAG -3'
(R):5'- AAGATGCTAACACGGCCTCAGTG -3'

Sequencing Primer
(F):5'- agcaagcacaaagccctc -3'
(R):5'- CCTCAGTGGCAGGTGTAGTC -3'
Posted On2013-04-12