Incidental Mutation 'R2032:Eml2'
ID 221353
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Name echinoderm microtubule associated protein like 2
Synonyms 1600029N02Rik
MMRRC Submission 040039-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2032 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19176421-19206482 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19202555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 711 (T711I)
Ref Sequence ENSEMBL: ENSMUSP00000112491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]
AlphaFold Q7TNG5
Predicted Effect probably benign
Transcript: ENSMUST00000048502
AA Change: T538I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: T538I

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117338
AA Change: T711I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: T711I

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120595
AA Change: T519I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: T519I

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,243,052 G674E probably damaging Het
Abca3 G A 17: 24,366,082 probably benign Het
Abca7 C T 10: 80,008,237 T1359M probably damaging Het
Acox2 A G 14: 8,246,400 S464P probably benign Het
Adgrf1 C T 17: 43,311,275 T801I probably damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Akap12 C A 10: 4,356,673 A1161D possibly damaging Het
Ankrd36 T A 11: 5,628,616 V635D possibly damaging Het
Ankrd44 C T 1: 54,723,009 probably null Het
Atl2 A G 17: 79,895,944 V28A probably benign Het
Atxn3 A T 12: 101,942,194 L133* probably null Het
Bmp2 T C 2: 133,561,296 S256P probably benign Het
Ccdc138 T A 10: 58,513,162 Y177N possibly damaging Het
Cep164 C T 9: 45,771,600 V931M probably damaging Het
CK137956 T C 4: 127,945,276 T450A probably benign Het
Col23a1 G A 11: 51,560,008 G215D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd6a T C 14: 26,604,749 M5T probably benign Het
Dnajc6 T G 4: 101,614,238 I284S probably benign Het
Dolpp1 C T 2: 30,392,441 A2V probably damaging Het
Evi5l T C 8: 4,210,622 D1065G probably damaging Het
Fam110b G T 4: 5,799,460 A293S probably benign Het
Fap A G 2: 62,542,237 V266A probably benign Het
Fgf10 A T 13: 118,715,595 Y71F probably damaging Het
Gm3443 G T 19: 21,555,800 G43C probably damaging Het
Gm4788 T A 1: 139,733,255 probably benign Het
Gm6583 G A 5: 112,355,112 T242I possibly damaging Het
Gm7257 T C 9: 36,432,899 probably null Het
Gm8251 C A 1: 44,061,740 C66F possibly damaging Het
Gpr146 T C 5: 139,379,147 probably benign Het
Hif3a A T 7: 17,051,179 L172H probably damaging Het
Mas1 T C 17: 12,842,570 probably benign Het
Nlrp5 G A 7: 23,421,512 R717Q probably damaging Het
Nop14 A G 5: 34,659,939 V36A possibly damaging Het
Olfr1417 C T 19: 11,828,300 C242Y probably damaging Het
Olfr33 A T 7: 102,713,876 I179N probably benign Het
Olfr57 T A 10: 79,035,329 F178I possibly damaging Het
Parp4 T A 14: 56,629,096 I1039K possibly damaging Het
Pold2 A T 11: 5,876,757 I59N probably benign Het
Prr36 T C 8: 4,214,304 probably benign Het
Pyroxd2 T C 19: 42,727,649 probably benign Het
Recql C T 6: 142,367,283 G403R probably damaging Het
Serpina3m T A 12: 104,389,669 D198E probably benign Het
Sik2 A T 9: 50,995,647 Y93N probably damaging Het
Slc27a3 C T 3: 90,387,397 R389H probably damaging Het
Slc29a1 A T 17: 45,586,109 M417K probably damaging Het
Syt13 A G 2: 92,953,401 K339E probably damaging Het
Tmem237 A T 1: 59,109,106 H163Q probably benign Het
Tram2 C T 1: 21,003,956 G253R probably null Het
Trpv1 A G 11: 73,238,385 T43A probably benign Het
Ugt2b34 A G 5: 86,891,272 I510T probably damaging Het
Vmn1r224 C A 17: 20,419,396 D78E probably benign Het
Vmn1r78 A T 7: 12,153,283 I274L probably benign Het
Wdfy4 C T 14: 33,146,989 V361I probably benign Het
Zpbp2 A T 11: 98,554,708 K165N probably damaging Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0628_Eml2_697 UTSW 7 19201554 splice site probably benign
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 splice site probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 splice site probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
R7706:Eml2 UTSW 7 19186110 missense possibly damaging 0.79
R7811:Eml2 UTSW 7 19186122 missense probably benign 0.38
R8084:Eml2 UTSW 7 19181224 critical splice donor site probably null
R8337:Eml2 UTSW 7 19196236 missense possibly damaging 0.84
R8414:Eml2 UTSW 7 19179295 missense probably damaging 1.00
R8868:Eml2 UTSW 7 19194063 missense probably benign 0.03
R8934:Eml2 UTSW 7 19179813 missense probably damaging 0.99
R9110:Eml2 UTSW 7 19191695 missense probably benign 0.07
R9131:Eml2 UTSW 7 19184826 missense
R9144:Eml2 UTSW 7 19201639 missense possibly damaging 0.75
R9261:Eml2 UTSW 7 19179818 missense probably benign 0.45
R9285:Eml2 UTSW 7 19191643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAGGCCTGTGTATCCTTCC -3'
(R):5'- CTGCTGTCCATTCATCAAAGC -3'

Sequencing Primer
(F):5'- AGGCCTGTGTATCCTTCCCTCTAG -3'
(R):5'- TGTCCATTCATCAAAGCCAAAGGG -3'
Posted On 2014-08-25