Mutagenetix > Incidental Mutations

Incidental Mutation 'R1974:Cep250'

221361

Institutional Source

Beutler Lab

Gene Symbol

Cep250

Ensembl Gene

ENSMUSG00000038241

Gene Name

centrosomal protein 250

Synonyms

Cep2, Inmp, B230210E21Rik

MMRRC Submission

039987-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1974 (G1)

Quality Score

214

Status

Not validated

Chromosome

Chromosomal Location

155956458-155998900 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155989504 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1294 (S1294P)

Ref Sequence

ENSEMBL: ENSMUSP00000091988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039994
AA Change: S1314P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: S1314P

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	4.2e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	327	N/A	INTRINSIC
internal_repeat_1	444	460	1.47e-18	PROSPERO
internal_repeat_1	465	481	1.47e-18	PROSPERO
low complexity region	495	506	N/A	INTRINSIC
low complexity region	557	580	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	635	650	N/A	INTRINSIC
low complexity region	669	677	N/A	INTRINSIC
low complexity region	688	703	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC
low complexity region	896	914	N/A	INTRINSIC
low complexity region	990	1007	N/A	INTRINSIC
low complexity region	1043	1053	N/A	INTRINSIC
low complexity region	1138	1143	N/A	INTRINSIC
low complexity region	1182	1195	N/A	INTRINSIC
coiled coil region	1257	1687	N/A	INTRINSIC
low complexity region	1872	1895	N/A	INTRINSIC
low complexity region	1919	1933	N/A	INTRINSIC
low complexity region	1941	1960	N/A	INTRINSIC
internal_repeat_2	2002	2052	3.9e-6	PROSPERO
coiled coil region	2068	2169	N/A	INTRINSIC
coiled coil region	2196	2217	N/A	INTRINSIC
coiled coil region	2251	2310	N/A	INTRINSIC
low complexity region	2325	2338	N/A	INTRINSIC
coiled coil region	2340	2366	N/A	INTRINSIC
low complexity region	2379	2388	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094421
AA Change: S1294P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: S1294P

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	5.4e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
coiled coil region	400	1165	N/A	INTRINSIC
coiled coil region	1237	1667	N/A	INTRINSIC
low complexity region	1852	1875	N/A	INTRINSIC
low complexity region	1899	1913	N/A	INTRINSIC
low complexity region	1921	1940	N/A	INTRINSIC
internal_repeat_1	1982	2032	3.35e-6	PROSPERO
coiled coil region	2048	2149	N/A	INTRINSIC
coiled coil region	2176	2197	N/A	INTRINSIC
coiled coil region	2231	2290	N/A	INTRINSIC
low complexity region	2305	2318	N/A	INTRINSIC
coiled coil region	2320	2346	N/A	INTRINSIC
low complexity region	2359	2368	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109619
AA Change: S1315P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: S1315P

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	214	4.1e-60	PFAM
low complexity region	215	225	N/A	INTRINSIC
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
internal_repeat_1	445	461	1.51e-18	PROSPERO
internal_repeat_1	466	482	1.51e-18	PROSPERO
low complexity region	496	507	N/A	INTRINSIC
low complexity region	558	581	N/A	INTRINSIC
low complexity region	584	596	N/A	INTRINSIC
low complexity region	636	651	N/A	INTRINSIC
low complexity region	670	678	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
low complexity region	709	720	N/A	INTRINSIC
low complexity region	897	915	N/A	INTRINSIC
low complexity region	991	1008	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1139	1144	N/A	INTRINSIC
low complexity region	1183	1196	N/A	INTRINSIC
coiled coil region	1258	1688	N/A	INTRINSIC
low complexity region	1873	1896	N/A	INTRINSIC
low complexity region	1920	1934	N/A	INTRINSIC
low complexity region	1942	1961	N/A	INTRINSIC
internal_repeat_2	2003	2053	3.95e-6	PROSPERO
coiled coil region	2069	2170	N/A	INTRINSIC
coiled coil region	2197	2218	N/A	INTRINSIC
coiled coil region	2252	2311	N/A	INTRINSIC
low complexity region	2326	2339	N/A	INTRINSIC
coiled coil region	2341	2367	N/A	INTRINSIC
low complexity region	2380	2389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124812

Predicted Effect

silent
Transcript: ENSMUST00000128683

SMART Domains

Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
coiled coil region	2	37	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149905

Predicted Effect

unknown
Transcript: ENSMUST00000156355
AA Change: S191P

SMART Domains

Protein: ENSMUSP00000122223
Gene: ENSMUSG00000038241
AA Change: S191P

Domain	Start	End	E-Value	Type
coiled coil region	12	47	N/A	INTRINSIC
coiled coil region	119	223	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,267	L739Q	probably damaging	Het
4933436I01Rik	A	T	X: 67,920,049	Y401*	probably null	Het
Abcg3	A	G	5: 104,963,638	V321A	probably benign	Het
Acad10	C	A	5: 121,626,185	V894L	possibly damaging	Het
Adam9	A	G	8: 24,992,224	I255T	probably damaging	Het
AF529169	T	G	9: 89,601,203	T714P	probably damaging	Het
Ago3	T	C	4: 126,346,751	Y785C	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Akap4	A	G	X: 7,077,356	S633G	probably benign	Het
Alox15	T	A	11: 70,349,973	T194S	probably benign	Het
Amh	T	C	10: 80,806,416	S207P	probably benign	Het
Apc	T	A	18: 34,300,004	C415S	possibly damaging	Het
Atg14	G	A	14: 47,545,841	R346C	probably damaging	Het
Atp5j2	A	T	5: 145,184,579	L64Q	probably damaging	Het
Barhl2	C	G	5: 106,457,313	E177Q	probably benign	Het
C1qtnf5	T	C	9: 44,108,775	V232A	probably damaging	Het
Calr	T	C	8: 84,844,157	I290V	probably benign	Het
Cdh19	G	C	1: 110,890,159	Q618E	possibly damaging	Het
Celsr2	G	T	3: 108,414,214	D427E	probably damaging	Het
Chrna7	T	A	7: 63,099,286	T483S	probably damaging	Het
Clmn	A	T	12: 104,791,862	W132R	probably damaging	Het
Cpsf2	G	A	12: 101,990,047	D370N	probably benign	Het
Crnn	T	C	3: 93,149,287	V460A	probably benign	Het
Daam1	T	A	12: 71,988,929	I957N	probably damaging	Het
Defb9	T	C	8: 21,881,889	K36R	probably benign	Het
Dock10	T	A	1: 80,510,426	I2007F	possibly damaging	Het
Dpm1	A	T	2: 168,217,747	V143D	probably damaging	Het
Dync1h1	T	C	12: 110,625,732	V1110A	possibly damaging	Het
Erlec1	T	G	11: 30,939,604	K373N	possibly damaging	Het
Fam160b1	T	C	19: 57,385,377	F690L	probably damaging	Het
Fbxo40	C	T	16: 36,969,941	G269E	probably benign	Het
Fbxw7	T	A	3: 84,954,935	C70S	possibly damaging	Het
Fnbp1	G	T	2: 31,053,047	R280S	probably null	Het
Gapvd1	G	A	2: 34,700,841	R940C	probably damaging	Het
Gfod2	T	C	8: 105,717,510	K134E	possibly damaging	Het
Gm13757	A	T	2: 88,446,509	I143N	probably damaging	Het
Gpi1	A	T	7: 34,220,803		probably null	Het
Grik2	A	T	10: 49,132,827	N721K	possibly damaging	Het
Gsn	G	T	2: 35,301,471	G455V	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Hpse	A	G	5: 100,692,238	S338P	probably damaging	Het
Hyal2	T	C	9: 107,572,172	C376R	probably damaging	Het
Inf2	A	G	12: 112,608,337	T781A	unknown	Het
Iscu	A	G	5: 113,777,018		probably benign	Het
Kcna4	G	A	2: 107,296,220	G433D	possibly damaging	Het
Kir3dl2	T	A	X: 136,456,275	N146I	probably benign	Het
Klrg1	T	A	6: 122,282,762	Q17L	possibly damaging	Het
Krt82	T	G	15: 101,545,162	Q263P	probably benign	Het
Mfrp	T	C	9: 44,106,372	C554R	probably damaging	Het
Mst1r	T	C	9: 107,914,763	Y833H	probably damaging	Het
Mst1r	T	A	9: 107,915,933		probably null	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nipal4	T	C	11: 46,151,383	N157S	probably damaging	Het
Notch2	G	A	3: 98,072,755	G195D	probably damaging	Het
Nrcam	A	T	12: 44,563,993	H492L	probably benign	Het
Olfr433	A	T	1: 174,042,588	I213F	probably damaging	Het
Papln	G	A	12: 83,782,037	R817H	probably damaging	Het
Pcnx2	T	C	8: 125,887,371	E447G	probably benign	Het
Pdp2	T	C	8: 104,593,906	V129A	probably benign	Het
Plch2	A	G	4: 154,984,953	F1072S	possibly damaging	Het
Prag1	T	A	8: 36,102,927	D221E	probably damaging	Het
Prkg1	T	C	19: 31,585,695	D102G	probably damaging	Het
Psme4	T	A	11: 30,819,011	D662E	probably benign	Het
Ptprn	T	C	1: 75,254,820		probably null	Het
Ptprz1	A	G	6: 22,986,311	D370G	probably damaging	Het
Qser1	A	G	2: 104,760,541	S1637P	probably damaging	Het
Sema6a	T	A	18: 47,270,629	H642L	probably benign	Het
Slc30a5	A	T	13: 100,813,953	F209I	probably benign	Het
Slc4a3	G	T	1: 75,552,191	E508*	probably null	Het
Stpg2	C	T	3: 139,309,183	R370*	probably null	Het
Tas2r113	T	A	6: 132,893,833	F275I	probably benign	Het
Tmem132d	T	G	5: 128,269,199	K86N	probably damaging	Het
Tpgs2	A	T	18: 25,140,536	F189L	probably damaging	Het
Trmt6	A	G	2: 132,811,048	S104P	probably damaging	Het
Trpv3	T	C	11: 73,283,688	S294P	probably damaging	Het
Ugt2b36	A	G	5: 87,080,868		probably null	Het
Vmn1r170	A	T	7: 23,606,481	M103L	probably benign	Het
Vmn2r107	T	A	17: 20,355,617		probably null	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Vmn2r77	T	C	7: 86,800,756	V70A	probably benign	Het

Other mutations in Cep250

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Cep250	APN	2	155991329	missense	probably benign	0.00
IGL01077:Cep250	APN	2	155962134	missense	probably damaging	1.00
IGL01084:Cep250	APN	2	155998393	missense	probably benign	0.00
IGL01400:Cep250	APN	2	155998291	missense	possibly damaging	0.78
IGL01570:Cep250	APN	2	155967663	splice site	probably benign
IGL01583:Cep250	APN	2	155976149	missense	probably damaging	0.99
IGL01590:Cep250	APN	2	155992317	missense	possibly damaging	0.80
IGL01647:Cep250	APN	2	155983376	missense	probably benign	0.02
IGL01959:Cep250	APN	2	155983359	missense	possibly damaging	0.63
IGL02066:Cep250	APN	2	155976521	missense	probably damaging	1.00
IGL02219:Cep250	APN	2	155991594	missense	probably benign	0.26
IGL02322:Cep250	APN	2	155990328	missense	probably damaging	1.00
IGL02728:Cep250	APN	2	155983278	unclassified	probably benign
IGL02955:Cep250	APN	2	155975756	missense	probably benign	0.01
IGL03369:Cep250	APN	2	155990271	missense	probably benign	0.00
R0366:Cep250	UTSW	2	155988401	missense	probably benign	0.00
R0403:Cep250	UTSW	2	155992349	missense	probably damaging	0.99
R0441:Cep250	UTSW	2	155972004	missense	possibly damaging	0.82
R0482:Cep250	UTSW	2	155964974	splice site	probably benign
R0507:Cep250	UTSW	2	155992532	missense	possibly damaging	0.60
R0614:Cep250	UTSW	2	155970097	nonsense	probably null
R0855:Cep250	UTSW	2	155964111	missense	probably damaging	1.00
R0973:Cep250	UTSW	2	155964289	splice site	probably benign
R1137:Cep250	UTSW	2	155990840	missense	probably benign	0.05
R1270:Cep250	UTSW	2	155990681	missense	probably benign	0.01
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1703:Cep250	UTSW	2	155965546	missense	probably benign	0.23
R1705:Cep250	UTSW	2	155963786	missense	probably damaging	1.00
R1740:Cep250	UTSW	2	155973356	missense	probably damaging	0.99
R1796:Cep250	UTSW	2	155992187	missense	possibly damaging	0.88
R1897:Cep250	UTSW	2	155976095	missense	probably damaging	1.00
R1900:Cep250	UTSW	2	155985374	critical splice donor site	probably null
R1958:Cep250	UTSW	2	155976381	splice site	probably null
R2015:Cep250	UTSW	2	155981453	missense	probably damaging	0.96
R2033:Cep250	UTSW	2	155970892	missense	probably damaging	0.99
R2224:Cep250	UTSW	2	155991817	missense	possibly damaging	0.94
R2266:Cep250	UTSW	2	155976170	missense	probably benign	0.13
R2278:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2332:Cep250	UTSW	2	155990607	missense	probably damaging	1.00
R2364:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2366:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2367:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2385:Cep250	UTSW	2	155974341	missense	probably damaging	1.00
R2830:Cep250	UTSW	2	155983316	missense	probably benign	0.00
R2895:Cep250	UTSW	2	155992122	missense	probably benign	0.00
R2965:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R2966:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R3016:Cep250	UTSW	2	155991288	missense	probably damaging	1.00
R3052:Cep250	UTSW	2	155991048	missense	probably damaging	0.99
R3424:Cep250	UTSW	2	155981461	missense	probably benign	0.02
R3930:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4085:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4087:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4088:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4090:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4110:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4355:Cep250	UTSW	2	155991525	missense	probably damaging	1.00
R4601:Cep250	UTSW	2	155962053	missense	probably benign	0.10
R4721:Cep250	UTSW	2	155970199	missense	probably damaging	1.00
R4995:Cep250	UTSW	2	155988316	missense	probably damaging	1.00
R5053:Cep250	UTSW	2	155962928	missense	possibly damaging	0.77
R5090:Cep250	UTSW	2	155976404	missense	probably damaging	1.00
R5744:Cep250	UTSW	2	155981474	missense	possibly damaging	0.60
R5775:Cep250	UTSW	2	155969374	missense	possibly damaging	0.92
R5986:Cep250	UTSW	2	155979277	missense	probably damaging	1.00
R6112:Cep250	UTSW	2	155994583	missense	possibly damaging	0.95
R6152:Cep250	UTSW	2	155981438	missense	possibly damaging	0.94
R6823:Cep250	UTSW	2	155981459	missense	probably benign	0.02
R6859:Cep250	UTSW	2	155992526	missense	probably benign	0.24
R6900:Cep250	UTSW	2	155996270	critical splice acceptor site	probably null
R7107:Cep250	UTSW	2	155995394	missense	probably benign	0.00
R7131:Cep250	UTSW	2	155965077	missense	probably damaging	1.00
R7178:Cep250	UTSW	2	155973455	nonsense	probably null
R7241:Cep250	UTSW	2	155991552	missense	probably benign	0.20
R7264:Cep250	UTSW	2	155979151	missense	probably damaging	0.99
R7290:Cep250	UTSW	2	155992762	missense	probably benign	0.03
R7367:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R7397:Cep250	UTSW	2	155981411	missense	probably damaging	0.99
R7768:Cep250	UTSW	2	155986009	missense
R7823:Cep250	UTSW	2	155965416	missense	possibly damaging	0.89
R8152:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R8331:Cep250	UTSW	2	155990253	missense	probably damaging	1.00
X0061:Cep250	UTSW	2	155961985	missense	probably benign	0.05
Z1177:Cep250	UTSW	2	155976467	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGAACTGATATGAGGAGCTCTG -3'
(R):5'- AAGGTGGGCCTGCTTCAAAG -3'

Sequencing Primer
(F):5'- ATTAGCAGACTGGGCTGTGC -3'
(R):5'- TTCAAAGCAATTCTCCCAAGGCG -3'

Posted On

2014-08-25