Incidental Mutation 'R1974:Dpm1'
ID221364
Institutional Source Beutler Lab
Gene Symbol Dpm1
Ensembl Gene ENSMUSG00000078919
Gene Namedolichol-phosphate (beta-D) mannosyltransferase 1
Synonyms
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1974 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168209048-168230591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 168217747 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 143 (V143D)
Ref Sequence ENSEMBL: ENSMUSP00000118776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109193] [ENSMUST00000138667] [ENSMUST00000154111]
Predicted Effect probably benign
Transcript: ENSMUST00000099072
SMART Domains Protein: ENSMUSP00000096671
Gene: ENSMUSG00000078919

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 16 118 1.8e-11 PFAM
Pfam:Glyco_tranf_2_2 20 119 1.3e-8 PFAM
Pfam:Glycos_transf_2 20 119 6.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109193
AA Change: V91D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104816
Gene: ENSMUSG00000078919
AA Change: V91D

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_2 2 101 1.2e-8 PFAM
Pfam:Glycos_transf_2 2 147 7.8e-36 PFAM
Pfam:Glyco_tranf_2_3 2 187 1.2e-11 PFAM
Pfam:Glyco_transf_21 34 148 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136582
Predicted Effect probably damaging
Transcript: ENSMUST00000138667
AA Change: V143D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752
AA Change: V143D

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153258
Predicted Effect probably damaging
Transcript: ENSMUST00000154111
AA Change: V143D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118776
Gene: ENSMUSG00000078919
AA Change: V143D

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 241 3.2e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 7.6e-10 PFAM
Pfam:Glycos_transf_2 28 199 8.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156800
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. Human DPM1 lacks a carboxy-terminal transmembrane domain and signal sequence and is regulated by DPM2. Mutations in this gene are associated with congenital disorder of glycosylation type Ie. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Dpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Dpm1 APN 2 168210575 missense probably benign 0.37
PIT4531001:Dpm1 UTSW 2 168210552 missense probably benign 0.42
R0200:Dpm1 UTSW 2 168223155 critical splice acceptor site probably null
R0212:Dpm1 UTSW 2 168227494 missense probably benign 0.00
R1460:Dpm1 UTSW 2 168210629 missense probably damaging 1.00
R1889:Dpm1 UTSW 2 168217735 missense possibly damaging 0.67
R4547:Dpm1 UTSW 2 168223153 missense probably damaging 0.98
R4838:Dpm1 UTSW 2 168210536 missense probably damaging 1.00
R4887:Dpm1 UTSW 2 168217759 missense probably benign 0.01
R6919:Dpm1 UTSW 2 168230275 missense probably damaging 1.00
R7169:Dpm1 UTSW 2 168211423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCTGGCTTTAAGAGGAGC -3'
(R):5'- TCAGACTCATTTGGACAGTCAGATC -3'

Sequencing Primer
(F):5'- TTTAAGAGGAGCAGAGTAAAGCTTTG -3'
(R):5'- CTCATTTGGACAGTCAGATCATCTGG -3'
Posted On2014-08-25