Incidental Mutation 'R1974:Ptprz1'
ID221399
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R1974 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22986311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 370 (D370G)
Ref Sequence ENSEMBL: ENSMUSP00000144605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102] [ENSMUST00000202579]
Predicted Effect probably damaging
Transcript: ENSMUST00000090568
AA Change: D370G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: D370G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201827
Predicted Effect probably benign
Transcript: ENSMUST00000202102
AA Change: D370G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748
AA Change: D370G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202579
AA Change: D370G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144605
Gene: ENSMUSG00000068748
AA Change: D370G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 38 300 4e-103 SMART
FN3 312 397 2.8e-6 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
R7599:Ptprz1 UTSW 6 23002519 missense not run
R7611:Ptprz1 UTSW 6 23001220 missense probably benign
R7685:Ptprz1 UTSW 6 23024978 missense probably damaging 1.00
R7707:Ptprz1 UTSW 6 23002296 missense probably benign 0.00
R7733:Ptprz1 UTSW 6 23000384 missense probably benign 0.31
R7786:Ptprz1 UTSW 6 23036993 missense probably damaging 1.00
R7868:Ptprz1 UTSW 6 23000964 missense not run
R7882:Ptprz1 UTSW 6 23002257 missense probably benign 0.13
R7951:Ptprz1 UTSW 6 23000964 missense not run
R7965:Ptprz1 UTSW 6 23002257 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCAGAAAATGTGCAAGCTG -3'
(R):5'- AATGCCTAAGTTTCCCATGTGTC -3'

Sequencing Primer
(F):5'- AATGTGCAAGCTGACCCTG -3'
(R):5'- CTTCCATAACATTGTTGACAGTGTC -3'
Posted On2014-08-25