Incidental Mutation 'R2032:Slc29a1'
ID221419
Institutional Source Beutler Lab
Gene Symbol Slc29a1
Ensembl Gene ENSMUSG00000023942
Gene Namesolute carrier family 29 (nucleoside transporters), member 1
SynonymsENT1, 1200014D21Rik, NBMPR-sensitive equilibrative nucleoside transporter
MMRRC Submission 040039-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2032 (G1)
Quality Score216
Status Validated
Chromosome17
Chromosomal Location45585200-45599606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45586109 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 417 (M417K)
Ref Sequence ENSEMBL: ENSMUSP00000126703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051574] [ENSMUST00000064889] [ENSMUST00000097317] [ENSMUST00000163492] [ENSMUST00000163905] [ENSMUST00000164217] [ENSMUST00000164618] [ENSMUST00000164769] [ENSMUST00000166119] [ENSMUST00000166633] [ENSMUST00000167195] [ENSMUST00000167332] [ENSMUST00000167692] [ENSMUST00000171847] [ENSMUST00000171081] [ENSMUST00000170113] [ENSMUST00000169729] [ENSMUST00000172301] [ENSMUST00000168274] [ENSMUST00000170488]
Predicted Effect probably damaging
Transcript: ENSMUST00000051574
AA Change: M419K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063096
Gene: ENSMUSG00000023942
AA Change: M419K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064889
AA Change: M417K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063757
Gene: ENSMUSG00000023942
AA Change: M417K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087588
Predicted Effect probably damaging
Transcript: ENSMUST00000097317
AA Change: M419K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094923
Gene: ENSMUSG00000023942
AA Change: M419K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163492
AA Change: M417K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129242
Gene: ENSMUSG00000023942
AA Change: M417K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163905
SMART Domains Protein: ENSMUSP00000129240
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164217
SMART Domains Protein: ENSMUSP00000131646
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164618
SMART Domains Protein: ENSMUSP00000126934
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164769
SMART Domains Protein: ENSMUSP00000131116
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 358 2.7e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166119
AA Change: M419K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128763
Gene: ENSMUSG00000023942
AA Change: M419K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166633
SMART Domains Protein: ENSMUSP00000131075
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 195 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167195
SMART Domains Protein: ENSMUSP00000133162
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167332
SMART Domains Protein: ENSMUSP00000131483
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167692
AA Change: M419K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131976
Gene: ENSMUSG00000023942
AA Change: M419K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167863
Predicted Effect probably damaging
Transcript: ENSMUST00000171847
AA Change: M417K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126703
Gene: ENSMUSG00000023942
AA Change: M417K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170425
Predicted Effect probably benign
Transcript: ENSMUST00000171081
SMART Domains Protein: ENSMUSP00000131217
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170113
SMART Domains Protein: ENSMUSP00000128304
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169729
SMART Domains Protein: ENSMUSP00000127343
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172301
SMART Domains Protein: ENSMUSP00000129345
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168274
Predicted Effect probably benign
Transcript: ENSMUST00000170488
Meta Mutation Damage Score 0.5138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit a slightly decreased body weight, increased alcohol preference and alcohol consumption, and reduced hypnotic and ataxic responses to ethanol associated with a reduction in adenosine tone. Adenosine uptake is almost completely abolished in mice homozygous for a knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,243,052 G674E probably damaging Het
Abca3 G A 17: 24,366,082 probably benign Het
Abca7 C T 10: 80,008,237 T1359M probably damaging Het
Acox2 A G 14: 8,246,400 S464P probably benign Het
Adgrf1 C T 17: 43,311,275 T801I probably damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Akap12 C A 10: 4,356,673 A1161D possibly damaging Het
Ankrd36 T A 11: 5,628,616 V635D possibly damaging Het
Ankrd44 C T 1: 54,723,009 probably null Het
Atl2 A G 17: 79,895,944 V28A probably benign Het
Atxn3 A T 12: 101,942,194 L133* probably null Het
Bmp2 T C 2: 133,561,296 S256P probably benign Het
Ccdc138 T A 10: 58,513,162 Y177N possibly damaging Het
Cep164 C T 9: 45,771,600 V931M probably damaging Het
CK137956 T C 4: 127,945,276 T450A probably benign Het
Col23a1 G A 11: 51,560,008 G215D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd6a T C 14: 26,604,749 M5T probably benign Het
Dnajc6 T G 4: 101,614,238 I284S probably benign Het
Dolpp1 C T 2: 30,392,441 A2V probably damaging Het
Eml2 C T 7: 19,202,555 T711I probably benign Het
Evi5l T C 8: 4,210,622 D1065G probably damaging Het
Fam110b G T 4: 5,799,460 A293S probably benign Het
Fap A G 2: 62,542,237 V266A probably benign Het
Fgf10 A T 13: 118,715,595 Y71F probably damaging Het
Gm3443 G T 19: 21,555,800 G43C probably damaging Het
Gm4788 T A 1: 139,733,255 probably benign Het
Gm6583 G A 5: 112,355,112 T242I possibly damaging Het
Gm7257 T C 9: 36,432,899 probably null Het
Gm8251 C A 1: 44,061,740 C66F possibly damaging Het
Gpr146 T C 5: 139,379,147 probably benign Het
Hif3a A T 7: 17,051,179 L172H probably damaging Het
Mas1 T C 17: 12,842,570 probably benign Het
Nlrp5 G A 7: 23,421,512 R717Q probably damaging Het
Nop14 A G 5: 34,659,939 V36A possibly damaging Het
Olfr1417 C T 19: 11,828,300 C242Y probably damaging Het
Olfr33 A T 7: 102,713,876 I179N probably benign Het
Olfr57 T A 10: 79,035,329 F178I possibly damaging Het
Parp4 T A 14: 56,629,096 I1039K possibly damaging Het
Pold2 A T 11: 5,876,757 I59N probably benign Het
Prr36 T C 8: 4,214,304 probably benign Het
Pyroxd2 T C 19: 42,727,649 probably benign Het
Recql C T 6: 142,367,283 G403R probably damaging Het
Serpina3m T A 12: 104,389,669 D198E probably benign Het
Sik2 A T 9: 50,995,647 Y93N probably damaging Het
Slc27a3 C T 3: 90,387,397 R389H probably damaging Het
Syt13 A G 2: 92,953,401 K339E probably damaging Het
Tmem237 A T 1: 59,109,106 H163Q probably benign Het
Tram2 C T 1: 21,003,956 G253R probably null Het
Trpv1 A G 11: 73,238,385 T43A probably benign Het
Ugt2b34 A G 5: 86,891,272 I510T probably damaging Het
Vmn1r224 C A 17: 20,419,396 D78E probably benign Het
Vmn1r78 A T 7: 12,153,283 I274L probably benign Het
Wdfy4 C T 14: 33,146,989 V361I probably benign Het
Zpbp2 A T 11: 98,554,708 K165N probably damaging Het
Other mutations in Slc29a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Slc29a1 APN 17 45589992 missense probably damaging 1.00
IGL01617:Slc29a1 APN 17 45589449 missense probably benign 0.02
IGL02154:Slc29a1 APN 17 45586163 missense probably damaging 1.00
soldate UTSW 17 45586263 missense probably damaging 1.00
veteran UTSW 17 45589921 critical splice donor site probably null
veterinarian UTSW 17 45586109 missense probably damaging 1.00
workhorse UTSW 17 45589066 nonsense probably null
R0288:Slc29a1 UTSW 17 45589804 missense probably damaging 1.00
R1168:Slc29a1 UTSW 17 45590278 missense probably damaging 1.00
R1676:Slc29a1 UTSW 17 45589010 missense probably damaging 0.98
R1777:Slc29a1 UTSW 17 45587308 missense probably damaging 1.00
R2413:Slc29a1 UTSW 17 45585717 missense probably damaging 1.00
R3917:Slc29a1 UTSW 17 45588973 splice site probably null
R4513:Slc29a1 UTSW 17 45589066 nonsense probably null
R4583:Slc29a1 UTSW 17 45589956 missense possibly damaging 0.67
R5244:Slc29a1 UTSW 17 45588413 unclassified probably benign
R6174:Slc29a1 UTSW 17 45589928 missense probably damaging 1.00
R6284:Slc29a1 UTSW 17 45589921 critical splice donor site probably null
R6446:Slc29a1 UTSW 17 45589245 missense possibly damaging 0.88
R6607:Slc29a1 UTSW 17 45588927 splice site probably null
R7133:Slc29a1 UTSW 17 45589971 missense possibly damaging 0.50
R7153:Slc29a1 UTSW 17 45585762 missense probably damaging 1.00
R7248:Slc29a1 UTSW 17 45592182 missense probably damaging 1.00
R7271:Slc29a1 UTSW 17 45588362 missense probably benign 0.01
R7604:Slc29a1 UTSW 17 45592324 splice site probably null
R7811:Slc29a1 UTSW 17 45586263 missense probably damaging 1.00
R8406:Slc29a1 UTSW 17 45589780 missense probably damaging 1.00
X0067:Slc29a1 UTSW 17 45590325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCACATTAGCAAGCCC -3'
(R):5'- GACTGACATGCGTGCTGAAG -3'

Sequencing Primer
(F):5'- ATTAGCAAGCCCTTACCTCCACTG -3'
(R):5'- ACATGCGTGCTGAAGCCTTG -3'
Posted On2014-08-25