Mutagenetix > Incidental Mutations

Incidental Mutation 'R1974:Nfix'

221422

Institutional Source

Beutler Lab

Gene Symbol

Nfix

Ensembl Gene

ENSMUSG00000001911

Gene Name

nuclear factor I/X

Synonyms

MMRRC Submission

039987-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.389) question?

Stock #

R1974 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

84699876-84800344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84726526 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 300 (R300C)

Ref Sequence

ENSEMBL: ENSMUSP00000115691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000098571] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]

Predicted Effect

probably damaging
Transcript: ENSMUST00000076715
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911
AA Change: R300C

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.1e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	322	7.4e-32	PFAM
Pfam:CTF_NFI	313	396	3.8e-19	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000098571

SMART Domains

Protein: ENSMUSP00000096170
Gene: ENSMUSG00000074203

Domain	Start	End	E-Value	Type
low complexity region	21	31	N/A	INTRINSIC
low complexity region	34	51	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	91	103	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099070
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911
AA Change: R300C

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.7e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	437	2.7e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109762
AA Change: R291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911
AA Change: R291C

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1.1e-27	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	312	5.4e-32	PFAM
Pfam:CTF_NFI	305	387	3.6e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109764
AA Change: R292C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: R292C

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1e-28	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	494	9.8e-137	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000126806
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: R300C

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	7.1e-31	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	488	1.5e-83	PFAM

Meta Mutation Damage Score

0.3011

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,267	L739Q	probably damaging	Het
4933436I01Rik	A	T	X: 67,920,049	Y401*	probably null	Het
Abcg3	A	G	5: 104,963,638	V321A	probably benign	Het
Acad10	C	A	5: 121,626,185	V894L	possibly damaging	Het
Adam9	A	G	8: 24,992,224	I255T	probably damaging	Het
AF529169	T	G	9: 89,601,203	T714P	probably damaging	Het
Ago3	T	C	4: 126,346,751	Y785C	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Akap4	A	G	X: 7,077,356	S633G	probably benign	Het
Alox15	T	A	11: 70,349,973	T194S	probably benign	Het
Amh	T	C	10: 80,806,416	S207P	probably benign	Het
Apc	T	A	18: 34,300,004	C415S	possibly damaging	Het
Atg14	G	A	14: 47,545,841	R346C	probably damaging	Het
Atp5j2	A	T	5: 145,184,579	L64Q	probably damaging	Het
Barhl2	C	G	5: 106,457,313	E177Q	probably benign	Het
C1qtnf5	T	C	9: 44,108,775	V232A	probably damaging	Het
Calr	T	C	8: 84,844,157	I290V	probably benign	Het
Cdh19	G	C	1: 110,890,159	Q618E	possibly damaging	Het
Celsr2	G	T	3: 108,414,214	D427E	probably damaging	Het
Cep250	T	C	2: 155,989,504	S1294P	probably damaging	Het
Chrna7	T	A	7: 63,099,286	T483S	probably damaging	Het
Clmn	A	T	12: 104,791,862	W132R	probably damaging	Het
Cpsf2	G	A	12: 101,990,047	D370N	probably benign	Het
Crnn	T	C	3: 93,149,287	V460A	probably benign	Het
Daam1	T	A	12: 71,988,929	I957N	probably damaging	Het
Defb9	T	C	8: 21,881,889	K36R	probably benign	Het
Dock10	T	A	1: 80,510,426	I2007F	possibly damaging	Het
Dpm1	A	T	2: 168,217,747	V143D	probably damaging	Het
Dync1h1	T	C	12: 110,625,732	V1110A	possibly damaging	Het
Erlec1	T	G	11: 30,939,604	K373N	possibly damaging	Het
Fam160b1	T	C	19: 57,385,377	F690L	probably damaging	Het
Fbxo40	C	T	16: 36,969,941	G269E	probably benign	Het
Fbxw7	T	A	3: 84,954,935	C70S	possibly damaging	Het
Fnbp1	G	T	2: 31,053,047	R280S	probably null	Het
Gapvd1	G	A	2: 34,700,841	R940C	probably damaging	Het
Gfod2	T	C	8: 105,717,510	K134E	possibly damaging	Het
Gm13757	A	T	2: 88,446,509	I143N	probably damaging	Het
Gpi1	A	T	7: 34,220,803		probably null	Het
Grik2	A	T	10: 49,132,827	N721K	possibly damaging	Het
Gsn	G	T	2: 35,301,471	G455V	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Hpse	A	G	5: 100,692,238	S338P	probably damaging	Het
Hyal2	T	C	9: 107,572,172	C376R	probably damaging	Het
Inf2	A	G	12: 112,608,337	T781A	unknown	Het
Iscu	A	G	5: 113,777,018		probably benign	Het
Kcna4	G	A	2: 107,296,220	G433D	possibly damaging	Het
Kir3dl2	T	A	X: 136,456,275	N146I	probably benign	Het
Klrg1	T	A	6: 122,282,762	Q17L	possibly damaging	Het
Krt82	T	G	15: 101,545,162	Q263P	probably benign	Het
Mfrp	T	C	9: 44,106,372	C554R	probably damaging	Het
Mst1r	T	C	9: 107,914,763	Y833H	probably damaging	Het
Mst1r	T	A	9: 107,915,933		probably null	Het
Nipal4	T	C	11: 46,151,383	N157S	probably damaging	Het
Notch2	G	A	3: 98,072,755	G195D	probably damaging	Het
Nrcam	A	T	12: 44,563,993	H492L	probably benign	Het
Olfr433	A	T	1: 174,042,588	I213F	probably damaging	Het
Papln	G	A	12: 83,782,037	R817H	probably damaging	Het
Pcnx2	T	C	8: 125,887,371	E447G	probably benign	Het
Pdp2	T	C	8: 104,593,906	V129A	probably benign	Het
Plch2	A	G	4: 154,984,953	F1072S	possibly damaging	Het
Prag1	T	A	8: 36,102,927	D221E	probably damaging	Het
Prkg1	T	C	19: 31,585,695	D102G	probably damaging	Het
Psme4	T	A	11: 30,819,011	D662E	probably benign	Het
Ptprn	T	C	1: 75,254,820		probably null	Het
Ptprz1	A	G	6: 22,986,311	D370G	probably damaging	Het
Qser1	A	G	2: 104,760,541	S1637P	probably damaging	Het
Sema6a	T	A	18: 47,270,629	H642L	probably benign	Het
Slc30a5	A	T	13: 100,813,953	F209I	probably benign	Het
Slc4a3	G	T	1: 75,552,191	E508*	probably null	Het
Stpg2	C	T	3: 139,309,183	R370*	probably null	Het
Tas2r113	T	A	6: 132,893,833	F275I	probably benign	Het
Tmem132d	T	G	5: 128,269,199	K86N	probably damaging	Het
Tpgs2	A	T	18: 25,140,536	F189L	probably damaging	Het
Trmt6	A	G	2: 132,811,048	S104P	probably damaging	Het
Trpv3	T	C	11: 73,283,688	S294P	probably damaging	Het
Ugt2b36	A	G	5: 87,080,868		probably null	Het
Vmn1r170	A	T	7: 23,606,481	M103L	probably benign	Het
Vmn2r107	T	A	17: 20,355,617		probably null	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Vmn2r77	T	C	7: 86,800,756	V70A	probably benign	Het

Other mutations in Nfix

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Nfix	APN	8	84726477	missense	probably damaging	0.99
IGL01919:Nfix	APN	8	84726474	missense	probably damaging	1.00
IGL01950:Nfix	APN	8	84713786	makesense	probably null
IGL02862:Nfix	APN	8	84713846	missense	probably benign	0.07
R0142:Nfix	UTSW	8	84721686	missense	probably damaging	1.00
R0309:Nfix	UTSW	8	84721774	missense	probably damaging	1.00
R0600:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0622:Nfix	UTSW	8	84726482	missense	probably damaging	0.99
R0628:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0882:Nfix	UTSW	8	84727925	missense	probably damaging	1.00
R0893:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0975:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1014:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1015:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1162:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1241:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1381:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1513:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1521:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1618:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1865:Nfix	UTSW	8	84772275	missense	possibly damaging	0.73
R1912:Nfix	UTSW	8	84721677	missense	probably damaging	1.00
R2208:Nfix	UTSW	8	84716247	frame shift	probably null
R2251:Nfix	UTSW	8	84716170	missense	probably benign	0.03
R2268:Nfix	UTSW	8	84716247	frame shift	probably null
R2270:Nfix	UTSW	8	84716247	frame shift	probably null
R2272:Nfix	UTSW	8	84727175	missense	probably damaging	1.00
R2346:Nfix	UTSW	8	84716247	frame shift	probably null
R2350:Nfix	UTSW	8	84716247	frame shift	probably null
R2963:Nfix	UTSW	8	84716247	frame shift	probably null
R2983:Nfix	UTSW	8	84716247	frame shift	probably null
R3008:Nfix	UTSW	8	84716247	frame shift	probably null
R3727:Nfix	UTSW	8	84716247	frame shift	probably null
R3791:Nfix	UTSW	8	84716247	frame shift	probably null
R4163:Nfix	UTSW	8	84716247	frame shift	probably null
R4164:Nfix	UTSW	8	84716247	frame shift	probably null
R4201:Nfix	UTSW	8	84716247	frame shift	probably null
R4206:Nfix	UTSW	8	84716247	frame shift	probably null
R4609:Nfix	UTSW	8	84726490	missense	probably damaging	1.00
R4801:Nfix	UTSW	8	84716247	frame shift	probably null
R4802:Nfix	UTSW	8	84716247	frame shift	probably null
R4914:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4915:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4916:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4918:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R5013:Nfix	UTSW	8	84772084	missense	possibly damaging	0.86
R5290:Nfix	UTSW	8	84713777	nonsense	probably null
R6418:Nfix	UTSW	8	84727149	missense	probably benign	0.01
R6554:Nfix	UTSW	8	84727650	missense	possibly damaging	0.93
R6786:Nfix	UTSW	8	84727647	missense	probably damaging	1.00
T0970:Nfix	UTSW	8	84726483	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGCAACTCTGAGCTCCTCATCC -3'
(R):5'- GGCAGATAAAGGTGCTTTGCC -3'

Sequencing Primer
(F):5'- ATCCCGCTCCTTGCCATCAG -3'
(R):5'- CAGATAAAGGTGCTTTGCCTGTTC -3'

Posted On

2014-08-25