Incidental Mutation 'R2033:Stk17b'
ID221432
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Nameserine/threonine kinase 17b (apoptosis-inducing)
Synonyms3110009A03Rik, Drak2
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53755506-53785224 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53761076 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 248 (S248P)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
Predicted Effect probably damaging
Transcript: ENSMUST00000027263
AA Change: S248P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: S248P

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187066
Meta Mutation Damage Score 0.3341 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53764140 missense probably damaging 0.99
IGL00767:Stk17b APN 1 53764023 splice site probably benign
IGL01012:Stk17b APN 1 53761037 missense probably benign 0.06
IGL01431:Stk17b APN 1 53765915 splice site probably benign
IGL01914:Stk17b APN 1 53761067 missense probably damaging 0.98
IGL02236:Stk17b APN 1 53764088 missense probably damaging 1.00
IGL02827:Stk17b APN 1 53776542 missense probably benign 0.03
R0013:Stk17b UTSW 1 53764132 missense probably benign 0.36
R0545:Stk17b UTSW 1 53762583 splice site probably benign
R0831:Stk17b UTSW 1 53757492 missense probably damaging 1.00
R1035:Stk17b UTSW 1 53762599 missense probably benign 0.22
R1375:Stk17b UTSW 1 53765947 missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53757590 missense probably damaging 1.00
R1809:Stk17b UTSW 1 53765981 missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53761082 missense probably damaging 1.00
R2105:Stk17b UTSW 1 53776605 missense probably benign 0.01
R2255:Stk17b UTSW 1 53776572 missense probably benign 0.00
R4395:Stk17b UTSW 1 53764115 missense probably damaging 0.98
R4521:Stk17b UTSW 1 53764038 missense probably damaging 1.00
R4777:Stk17b UTSW 1 53771708 missense probably damaging 1.00
R4871:Stk17b UTSW 1 53757534 missense probably benign 0.14
R4892:Stk17b UTSW 1 53771611 missense probably damaging 0.99
R4999:Stk17b UTSW 1 53761147 unclassified probably null
R5122:Stk17b UTSW 1 53776558 missense probably damaging 1.00
R5621:Stk17b UTSW 1 53771784 nonsense probably null
R6636:Stk17b UTSW 1 53761088 missense probably damaging 1.00
R6924:Stk17b UTSW 1 53761059 missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53757515 missense probably benign
R7322:Stk17b UTSW 1 53765945 missense probably benign 0.16
R7671:Stk17b UTSW 1 53766000 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGTCTTTAGCAGGCACAC -3'
(R):5'- TCTGTGGTACAGTAATCTCTAGAAG -3'

Sequencing Primer
(F):5'- GTCTTTAGCAGGCACACATTATTTGG -3'
(R):5'- AAACTTTGCCAGACTTGTGGAC -3'
Posted On2014-08-25