Mutagenetix > Incidental Mutation

Incidental Mutation 'R1974:Mst1r'

221441

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

039987-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R1974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 107915933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably null
Transcript: ENSMUST00000035203

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195113

Predicted Effect

probably benign
Transcript: ENSMUST00000195617

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,267	L739Q	probably damaging	Het
4933436I01Rik	A	T	X: 67,920,049	Y401*	probably null	Het
Abcg3	A	G	5: 104,963,638	V321A	probably benign	Het
Acad10	C	A	5: 121,626,185	V894L	possibly damaging	Het
Adam9	A	G	8: 24,992,224	I255T	probably damaging	Het
AF529169	T	G	9: 89,601,203	T714P	probably damaging	Het
Ago3	T	C	4: 126,346,751	Y785C	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Akap4	A	G	X: 7,077,356	S633G	probably benign	Het
Alox15	T	A	11: 70,349,973	T194S	probably benign	Het
Amh	T	C	10: 80,806,416	S207P	probably benign	Het
Apc	T	A	18: 34,300,004	C415S	possibly damaging	Het
Atg14	G	A	14: 47,545,841	R346C	probably damaging	Het
Atp5j2	A	T	5: 145,184,579	L64Q	probably damaging	Het
Barhl2	C	G	5: 106,457,313	E177Q	probably benign	Het
C1qtnf5	T	C	9: 44,108,775	V232A	probably damaging	Het
Calr	T	C	8: 84,844,157	I290V	probably benign	Het
Cdh19	G	C	1: 110,890,159	Q618E	possibly damaging	Het
Celsr2	G	T	3: 108,414,214	D427E	probably damaging	Het
Cep250	T	C	2: 155,989,504	S1294P	probably damaging	Het
Chrna7	T	A	7: 63,099,286	T483S	probably damaging	Het
Clmn	A	T	12: 104,791,862	W132R	probably damaging	Het
Cpsf2	G	A	12: 101,990,047	D370N	probably benign	Het
Crnn	T	C	3: 93,149,287	V460A	probably benign	Het
Daam1	T	A	12: 71,988,929	I957N	probably damaging	Het
Defb9	T	C	8: 21,881,889	K36R	probably benign	Het
Dock10	T	A	1: 80,510,426	I2007F	possibly damaging	Het
Dpm1	A	T	2: 168,217,747	V143D	probably damaging	Het
Dync1h1	T	C	12: 110,625,732	V1110A	possibly damaging	Het
Erlec1	T	G	11: 30,939,604	K373N	possibly damaging	Het
Fam160b1	T	C	19: 57,385,377	F690L	probably damaging	Het
Fbxo40	C	T	16: 36,969,941	G269E	probably benign	Het
Fbxw7	T	A	3: 84,954,935	C70S	possibly damaging	Het
Fnbp1	G	T	2: 31,053,047	R280S	probably null	Het
Gapvd1	G	A	2: 34,700,841	R940C	probably damaging	Het
Gfod2	T	C	8: 105,717,510	K134E	possibly damaging	Het
Gm13757	A	T	2: 88,446,509	I143N	probably damaging	Het
Gpi1	A	T	7: 34,220,803		probably null	Het
Grik2	A	T	10: 49,132,827	N721K	possibly damaging	Het
Gsn	G	T	2: 35,301,471	G455V	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Hpse	A	G	5: 100,692,238	S338P	probably damaging	Het
Hyal2	T	C	9: 107,572,172	C376R	probably damaging	Het
Inf2	A	G	12: 112,608,337	T781A	unknown	Het
Iscu	A	G	5: 113,777,018		probably benign	Het
Kcna4	G	A	2: 107,296,220	G433D	possibly damaging	Het
Kir3dl2	T	A	X: 136,456,275	N146I	probably benign	Het
Klrg1	T	A	6: 122,282,762	Q17L	possibly damaging	Het
Krt82	T	G	15: 101,545,162	Q263P	probably benign	Het
Mfrp	T	C	9: 44,106,372	C554R	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nipal4	T	C	11: 46,151,383	N157S	probably damaging	Het
Notch2	G	A	3: 98,072,755	G195D	probably damaging	Het
Nrcam	A	T	12: 44,563,993	H492L	probably benign	Het
Olfr433	A	T	1: 174,042,588	I213F	probably damaging	Het
Papln	G	A	12: 83,782,037	R817H	probably damaging	Het
Pcnx2	T	C	8: 125,887,371	E447G	probably benign	Het
Pdp2	T	C	8: 104,593,906	V129A	probably benign	Het
Plch2	A	G	4: 154,984,953	F1072S	possibly damaging	Het
Prag1	T	A	8: 36,102,927	D221E	probably damaging	Het
Prkg1	T	C	19: 31,585,695	D102G	probably damaging	Het
Psme4	T	A	11: 30,819,011	D662E	probably benign	Het
Ptprn	T	C	1: 75,254,820		probably null	Het
Ptprz1	A	G	6: 22,986,311	D370G	probably damaging	Het
Qser1	A	G	2: 104,760,541	S1637P	probably damaging	Het
Sema6a	T	A	18: 47,270,629	H642L	probably benign	Het
Slc30a5	A	T	13: 100,813,953	F209I	probably benign	Het
Slc4a3	G	T	1: 75,552,191	E508*	probably null	Het
Stpg2	C	T	3: 139,309,183	R370*	probably null	Het
Tas2r113	T	A	6: 132,893,833	F275I	probably benign	Het
Tmem132d	T	G	5: 128,269,199	K86N	probably damaging	Het
Tpgs2	A	T	18: 25,140,536	F189L	probably damaging	Het
Trmt6	A	G	2: 132,811,048	S104P	probably damaging	Het
Trpv3	T	C	11: 73,283,688	S294P	probably damaging	Het
Ugt2b36	A	G	5: 87,080,868		probably null	Het
Vmn1r170	A	T	7: 23,606,481	M103L	probably benign	Het
Vmn2r107	T	A	17: 20,355,617		probably null	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Vmn2r77	T	C	7: 86,800,756	V70A	probably benign	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCGAACCATGAAGAATCGTCAG -3'
(R):5'- GTAGGGTCGTTTACAGTCCTC -3'

Sequencing Primer
(F):5'- CCATGAAGAATCGTCAGAGAGTAG -3'
(R):5'- GCCACCGAAGAGCAAATTCTC -3'

Posted On

2014-08-25