Incidental Mutation 'R2033:Gpr155'
ID 221442
Institutional Source Beutler Lab
Gene Symbol Gpr155
Ensembl Gene ENSMUSG00000041762
Gene Name G protein-coupled receptor 155
Synonyms DEPDC3, 1110017O10Rik, PGR22, F730029F15Rik
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 73171850-73216842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73178526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 726 (H726L)
Ref Sequence ENSEMBL: ENSMUSP00000107675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076463] [ENSMUST00000112043] [ENSMUST00000112044]
AlphaFold A2AWR3
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048504
SMART Domains Protein: ENSMUSP00000037772
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 1.9e-16 PFAM
Pfam:Mem_trans 187 360 4.9e-12 PFAM
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076463
AA Change: H754L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075788
Gene: ENSMUSG00000041762
AA Change: H754L

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112043
AA Change: H754L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107674
Gene: ENSMUSG00000041762
AA Change: H754L

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112044
AA Change: H726L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107675
Gene: ENSMUSG00000041762
AA Change: H726L

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
Pfam:Mem_trans 187 360 8.3e-11 PFAM
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 414 436 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
transmembrane domain 629 651 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
DEP 731 805 8.28e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131430
AA Change: H194L
SMART Domains Protein: ENSMUSP00000114294
Gene: ENSMUSG00000041762
AA Change: H194L

DomainStartEndE-ValueType
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184503
Meta Mutation Damage Score 0.0858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Gpr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gpr155 APN 2 73,192,957 (GRCm39) missense probably damaging 1.00
IGL01432:Gpr155 APN 2 73,182,229 (GRCm39) missense possibly damaging 0.51
IGL01528:Gpr155 APN 2 73,192,767 (GRCm39) critical splice donor site probably null
IGL01718:Gpr155 APN 2 73,212,576 (GRCm39) missense probably benign
IGL01733:Gpr155 APN 2 73,183,956 (GRCm39) splice site probably null
IGL03342:Gpr155 APN 2 73,180,022 (GRCm39) missense probably damaging 1.00
PIT1430001:Gpr155 UTSW 2 73,200,482 (GRCm39) missense probably benign 0.08
PIT4810001:Gpr155 UTSW 2 73,178,607 (GRCm39) missense probably benign 0.08
R0226:Gpr155 UTSW 2 73,197,936 (GRCm39) missense probably benign 0.02
R0399:Gpr155 UTSW 2 73,200,346 (GRCm39) missense possibly damaging 0.91
R0445:Gpr155 UTSW 2 73,200,488 (GRCm39) splice site probably benign
R1570:Gpr155 UTSW 2 73,200,382 (GRCm39) missense possibly damaging 0.87
R1598:Gpr155 UTSW 2 73,200,434 (GRCm39) missense probably damaging 0.98
R1647:Gpr155 UTSW 2 73,194,508 (GRCm39) splice site probably null
R1648:Gpr155 UTSW 2 73,194,508 (GRCm39) splice site probably null
R1756:Gpr155 UTSW 2 73,197,921 (GRCm39) missense probably benign 0.00
R1760:Gpr155 UTSW 2 73,212,279 (GRCm39) missense probably damaging 1.00
R2044:Gpr155 UTSW 2 73,203,977 (GRCm39) missense probably damaging 1.00
R2145:Gpr155 UTSW 2 73,187,002 (GRCm39) missense probably benign 0.01
R2172:Gpr155 UTSW 2 73,212,471 (GRCm39) missense probably benign 0.00
R2274:Gpr155 UTSW 2 73,178,479 (GRCm39) critical splice donor site probably null
R3878:Gpr155 UTSW 2 73,198,736 (GRCm39) nonsense probably null
R3924:Gpr155 UTSW 2 73,200,420 (GRCm39) missense probably damaging 1.00
R4910:Gpr155 UTSW 2 73,197,882 (GRCm39) nonsense probably null
R4950:Gpr155 UTSW 2 73,212,529 (GRCm39) missense probably benign
R5337:Gpr155 UTSW 2 73,178,592 (GRCm39) missense probably benign 0.32
R5830:Gpr155 UTSW 2 73,200,433 (GRCm39) missense possibly damaging 0.93
R5887:Gpr155 UTSW 2 73,174,062 (GRCm39) nonsense probably null
R5929:Gpr155 UTSW 2 73,204,011 (GRCm39) nonsense probably null
R6293:Gpr155 UTSW 2 73,204,341 (GRCm39) missense possibly damaging 0.47
R6553:Gpr155 UTSW 2 73,179,989 (GRCm39) missense probably damaging 1.00
R6585:Gpr155 UTSW 2 73,179,989 (GRCm39) missense probably damaging 1.00
R7003:Gpr155 UTSW 2 73,173,961 (GRCm39) missense probably damaging 0.99
R7353:Gpr155 UTSW 2 73,197,835 (GRCm39) nonsense probably null
R7506:Gpr155 UTSW 2 73,198,683 (GRCm39) missense probably damaging 0.97
R7631:Gpr155 UTSW 2 73,213,291 (GRCm39) intron probably benign
R7753:Gpr155 UTSW 2 73,212,550 (GRCm39) missense probably benign 0.27
R7810:Gpr155 UTSW 2 73,212,296 (GRCm39) missense probably damaging 0.99
R7813:Gpr155 UTSW 2 73,212,329 (GRCm39) nonsense probably null
R7815:Gpr155 UTSW 2 73,192,904 (GRCm39) missense probably benign
R7873:Gpr155 UTSW 2 73,173,934 (GRCm39) missense possibly damaging 0.51
R8506:Gpr155 UTSW 2 73,173,806 (GRCm39) missense probably damaging 0.99
R8680:Gpr155 UTSW 2 73,174,039 (GRCm39) missense probably damaging 0.99
R8856:Gpr155 UTSW 2 73,203,993 (GRCm39) missense probably benign 0.27
R8872:Gpr155 UTSW 2 73,197,936 (GRCm39) missense probably benign 0.02
R9116:Gpr155 UTSW 2 73,204,109 (GRCm39) missense possibly damaging 0.78
R9683:Gpr155 UTSW 2 73,192,780 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCTAATGGCCGACATGTAG -3'
(R):5'- GGTTCAGCGATCAATGAAATCCC -3'

Sequencing Primer
(F):5'- CCGACATGTAGAGAATGTTAATCGCC -3'
(R):5'- TGAAATCCCCATGTGGATGAC -3'
Posted On 2014-08-25