Incidental Mutation 'R2033:Rtel1'
ID 221454
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Name regulator of telomere elongation helicase 1
Synonyms
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 180961532-180998409 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 180993656 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 592 (K592*)
Ref Sequence ENSEMBL: ENSMUSP00000116159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000148252]
AlphaFold Q0VGM9
Predicted Effect probably null
Transcript: ENSMUST00000048608
AA Change: K776*
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: K776*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably null
Transcript: ENSMUST00000054622
AA Change: K776*
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: K776*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098971
AA Change: K776*
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: K776*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108814
AA Change: K776*
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: K776*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108815
AA Change: K776*
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: K776*

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126842
Predicted Effect probably benign
Transcript: ENSMUST00000133856
Predicted Effect probably benign
Transcript: ENSMUST00000134651
Predicted Effect probably benign
Transcript: ENSMUST00000137700
Predicted Effect probably null
Transcript: ENSMUST00000148252
AA Change: K592*
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: K592*

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184751
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 180,996,194 (GRCm39) missense probably benign 0.16
IGL01957:Rtel1 APN 2 180,991,106 (GRCm39) unclassified probably benign
IGL02247:Rtel1 APN 2 180,993,134 (GRCm39) nonsense probably null
IGL02414:Rtel1 APN 2 180,977,765 (GRCm39) missense probably benign 0.01
IGL02448:Rtel1 APN 2 180,977,830 (GRCm39) missense probably benign 0.00
IGL03053:Rtel1 APN 2 180,993,737 (GRCm39) missense probably benign 0.02
IGL03059:Rtel1 APN 2 180,991,976 (GRCm39) missense probably benign 0.01
IGL03326:Rtel1 APN 2 180,997,354 (GRCm39) unclassified probably benign
PIT4283001:Rtel1 UTSW 2 180,988,683 (GRCm39) missense probably benign 0.00
R0047:Rtel1 UTSW 2 180,965,198 (GRCm39) missense probably damaging 1.00
R0047:Rtel1 UTSW 2 180,965,198 (GRCm39) missense probably damaging 1.00
R0051:Rtel1 UTSW 2 180,992,449 (GRCm39) nonsense probably null
R0051:Rtel1 UTSW 2 180,992,449 (GRCm39) nonsense probably null
R0147:Rtel1 UTSW 2 180,962,839 (GRCm39) missense probably damaging 1.00
R0148:Rtel1 UTSW 2 180,962,839 (GRCm39) missense probably damaging 1.00
R0316:Rtel1 UTSW 2 180,997,795 (GRCm39) missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 180,993,674 (GRCm39) missense probably benign 0.03
R0940:Rtel1 UTSW 2 180,964,596 (GRCm39) missense probably benign 0.36
R1165:Rtel1 UTSW 2 180,976,732 (GRCm39) missense probably benign 0.26
R1213:Rtel1 UTSW 2 180,993,128 (GRCm39) missense probably benign 0.01
R1291:Rtel1 UTSW 2 180,992,836 (GRCm39) missense probably damaging 1.00
R1353:Rtel1 UTSW 2 180,991,024 (GRCm39) missense probably benign
R1398:Rtel1 UTSW 2 180,977,658 (GRCm39) splice site probably null
R1796:Rtel1 UTSW 2 180,993,896 (GRCm39) missense probably benign 0.01
R1973:Rtel1 UTSW 2 180,993,419 (GRCm39) missense probably benign 0.04
R2144:Rtel1 UTSW 2 180,965,499 (GRCm39) missense probably damaging 0.97
R2265:Rtel1 UTSW 2 180,996,161 (GRCm39) missense probably damaging 1.00
R2269:Rtel1 UTSW 2 180,977,796 (GRCm39) missense probably benign 0.00
R2416:Rtel1 UTSW 2 180,982,324 (GRCm39) missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 180,991,765 (GRCm39) missense probably benign 0.36
R3508:Rtel1 UTSW 2 180,964,202 (GRCm39) missense probably benign 0.32
R4242:Rtel1 UTSW 2 180,991,727 (GRCm39) missense probably damaging 1.00
R4377:Rtel1 UTSW 2 180,997,589 (GRCm39) missense probably damaging 1.00
R4702:Rtel1 UTSW 2 180,993,962 (GRCm39) missense probably benign 0.30
R4706:Rtel1 UTSW 2 180,965,539 (GRCm39) critical splice donor site probably null
R4817:Rtel1 UTSW 2 180,997,728 (GRCm39) missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 180,964,307 (GRCm39) splice site probably null
R5069:Rtel1 UTSW 2 180,997,285 (GRCm39) missense probably benign 0.03
R5222:Rtel1 UTSW 2 180,988,776 (GRCm39) intron probably benign
R5268:Rtel1 UTSW 2 180,982,354 (GRCm39) missense probably benign 0.03
R5291:Rtel1 UTSW 2 180,993,888 (GRCm39) missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 180,993,893 (GRCm39) missense probably benign
R5682:Rtel1 UTSW 2 180,991,765 (GRCm39) missense probably benign 0.19
R5796:Rtel1 UTSW 2 180,982,299 (GRCm39) missense probably benign 0.26
R5931:Rtel1 UTSW 2 180,972,608 (GRCm39) nonsense probably null
R6249:Rtel1 UTSW 2 180,993,475 (GRCm39) missense probably damaging 1.00
R6465:Rtel1 UTSW 2 180,977,733 (GRCm39) missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 180,994,579 (GRCm39) missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 180,964,256 (GRCm39) missense probably benign 0.31
R6835:Rtel1 UTSW 2 180,997,746 (GRCm39) missense probably benign 0.04
R6917:Rtel1 UTSW 2 180,980,070 (GRCm39) makesense probably null
R7264:Rtel1 UTSW 2 180,993,654 (GRCm39) missense not run
R7381:Rtel1 UTSW 2 180,972,608 (GRCm39) nonsense probably null
R7523:Rtel1 UTSW 2 180,964,108 (GRCm39) missense probably damaging 1.00
R7587:Rtel1 UTSW 2 180,964,108 (GRCm39) missense probably damaging 1.00
R7681:Rtel1 UTSW 2 180,964,187 (GRCm39) missense probably damaging 0.99
R7871:Rtel1 UTSW 2 180,962,822 (GRCm39) missense probably damaging 1.00
R7912:Rtel1 UTSW 2 180,997,869 (GRCm39) missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 180,976,767 (GRCm39) missense probably damaging 1.00
R8062:Rtel1 UTSW 2 180,982,360 (GRCm39) missense probably benign 0.17
R8088:Rtel1 UTSW 2 180,964,138 (GRCm39) missense probably damaging 1.00
R8435:Rtel1 UTSW 2 180,995,897 (GRCm39) missense possibly damaging 0.93
R8873:Rtel1 UTSW 2 180,997,816 (GRCm39) frame shift probably null
R9441:Rtel1 UTSW 2 180,988,860 (GRCm39) missense possibly damaging 0.89
R9704:Rtel1 UTSW 2 180,993,905 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAACTGTGAGCTCCAAATGCC -3'
(R):5'- AAATGTCTGCTGCTCATACTCC -3'

Sequencing Primer
(F):5'- AAATGCCCGGTTGACTTGC -3'
(R):5'- TGCTCTCAGAGTCTCCAGCAG -3'
Posted On 2014-08-25