Incidental Mutation 'R2033:Pde4b'
ID221458
Institutional Source Beutler Lab
Gene Symbol Pde4b
Ensembl Gene ENSMUSG00000028525
Gene Namephosphodiesterase 4B, cAMP specific
Synonymsdunce, Dpde4
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location102087543-102607259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102605295 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 723 (D723Y)
Ref Sequence ENSEMBL: ENSMUSP00000102524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030251] [ENSMUST00000097949] [ENSMUST00000097950] [ENSMUST00000106901] [ENSMUST00000106904] [ENSMUST00000106908] [ENSMUST00000106911]
Predicted Effect probably benign
Transcript: ENSMUST00000030251
AA Change: D471Y

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030251
Gene: ENSMUSG00000028525
AA Change: D471Y

DomainStartEndE-ValueType
HDc 151 326 2.35e-5 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097949
AA Change: D490Y

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095561
Gene: ENSMUSG00000028525
AA Change: D490Y

DomainStartEndE-ValueType
HDc 170 345 2.35e-5 SMART
low complexity region 452 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097950
AA Change: D551Y

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095562
Gene: ENSMUSG00000028525
AA Change: D551Y

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
HDc 231 406 2.35e-5 SMART
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106901
SMART Domains Protein: ENSMUSP00000102514
Gene: ENSMUSG00000028525

DomainStartEndE-ValueType
HDc 170 345 2.35e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106904
AA Change: D646Y

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102517
Gene: ENSMUSG00000028525
AA Change: D646Y

DomainStartEndE-ValueType
HDc 326 501 2.35e-5 SMART
low complexity region 608 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106908
AA Change: D708Y

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102521
Gene: ENSMUSG00000028525
AA Change: D708Y

DomainStartEndE-ValueType
HDc 388 563 2.35e-5 SMART
low complexity region 670 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106911
AA Change: D723Y

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102524
Gene: ENSMUSG00000028525
AA Change: D723Y

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
HDc 403 578 2.35e-5 SMART
low complexity region 685 698 N/A INTRINSIC
Meta Mutation Damage Score 0.1342 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene produce significantly less TNF-alpha in response to lipopolysaccharide stimulation. One mutation resulted in brain and spinal cord vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Pde4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Pde4b APN 4 102506044 critical splice donor site probably null
IGL01146:Pde4b APN 4 102255263 missense possibly damaging 0.80
IGL01377:Pde4b APN 4 102487402 missense probably damaging 1.00
IGL01549:Pde4b APN 4 102605068 missense probably damaging 0.97
IGL01739:Pde4b APN 4 102601635 missense probably damaging 0.97
IGL01791:Pde4b APN 4 102590930 splice site probably benign
IGL02211:Pde4b APN 4 102590822 splice site probably benign
IGL02578:Pde4b APN 4 102255297 missense possibly damaging 0.94
IGL02878:Pde4b APN 4 102601639 missense probably damaging 1.00
PIT4458001:Pde4b UTSW 4 102602678 missense probably damaging 1.00
PIT4618001:Pde4b UTSW 4 102602812 missense probably benign 0.09
R0102:Pde4b UTSW 4 102590178 missense probably benign 0.15
R0230:Pde4b UTSW 4 102597510 missense probably benign 0.01
R0530:Pde4b UTSW 4 102602651 missense probably damaging 0.96
R0704:Pde4b UTSW 4 102487392 missense probably damaging 0.99
R1115:Pde4b UTSW 4 102542155 intron probably benign
R1450:Pde4b UTSW 4 102601635 missense probably damaging 0.97
R1457:Pde4b UTSW 4 102605176 missense probably damaging 0.99
R1568:Pde4b UTSW 4 102597699 missense probably damaging 1.00
R1740:Pde4b UTSW 4 102487351 missense probably damaging 1.00
R1784:Pde4b UTSW 4 102605260 missense probably benign 0.02
R1960:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R1961:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R2210:Pde4b UTSW 4 102597475 missense probably damaging 1.00
R2848:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R2936:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3195:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3196:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3695:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3699:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R4014:Pde4b UTSW 4 102555625 missense probably benign 0.00
R4627:Pde4b UTSW 4 102601605 missense probably damaging 1.00
R4852:Pde4b UTSW 4 102597770 missense probably damaging 1.00
R5055:Pde4b UTSW 4 102195114 intron probably benign
R5109:Pde4b UTSW 4 102601544 missense probably damaging 1.00
R5319:Pde4b UTSW 4 102421788 utr 3 prime probably benign
R5476:Pde4b UTSW 4 102602699 missense probably benign 0.00
R5576:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6019:Pde4b UTSW 4 102570769 missense possibly damaging 0.56
R6151:Pde4b UTSW 4 102601551 missense probably damaging 1.00
R6540:Pde4b UTSW 4 102601876 missense probably damaging 1.00
R6573:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6662:Pde4b UTSW 4 102601898 missense possibly damaging 0.82
R6751:Pde4b UTSW 4 102602671 missense probably damaging 0.98
R7066:Pde4b UTSW 4 102602806 missense probably benign 0.03
R7092:Pde4b UTSW 4 102601851 missense probably damaging 1.00
R7461:Pde4b UTSW 4 102255306 missense probably damaging 1.00
R7613:Pde4b UTSW 4 102255306 missense probably damaging 1.00
R8068:Pde4b UTSW 4 102596015 missense probably damaging 1.00
R8296:Pde4b UTSW 4 102602786 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CAGAGTATGATACCCCAGAGCC -3'
(R):5'- TGGCATTCTGGCTCCAAACTC -3'

Sequencing Primer
(F):5'- GTATGATACCCCAGAGCCCTTCC -3'
(R):5'- TTCTGGCTCCAAACTCAAGTAACTG -3'
Posted On2014-08-25