Incidental Mutation 'R1974:Daam1'
ID221463
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1974 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71988929 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 957 (I957N)
Ref Sequence ENSEMBL: ENSMUSP00000152532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect probably benign
Transcript: ENSMUST00000085299
AA Change: I966N

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: I966N

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221317
AA Change: I957N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000223272
AA Change: I966N

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAGGTAAATAATTGGCTG -3'
(R):5'- TATCTGTCGTCATGTGGCACC -3'

Sequencing Primer
(F):5'- TAATTGGCTGGCTAAGAACCCTC -3'
(R):5'- GGGAAAGGCCAACCCACTG -3'
Posted On2014-08-25