Incidental Mutation 'R2033:Galnt11'
ID 221464
Institutional Source Beutler Lab
Gene Symbol Galnt11
Ensembl Gene ENSMUSG00000038072
Gene Name polypeptide N-acetylgalactosaminyltransferase 11
Synonyms A430075I06Rik, E430002F06Rik
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 25427732-25470916 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25452536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 16 (T16I)
Ref Sequence ENSEMBL: ENSMUSP00000110602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045737] [ENSMUST00000114950] [ENSMUST00000114952] [ENSMUST00000144971]
AlphaFold Q921L8
Predicted Effect probably damaging
Transcript: ENSMUST00000045737
AA Change: T16I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036240
Gene: ENSMUSG00000038072
AA Change: T16I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 386 5.3e-9 PFAM
Pfam:Glycos_transf_2 154 337 3.7e-33 PFAM
Pfam:Glyco_transf_7C 315 383 2.1e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114950
AA Change: T16I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110600
Gene: ENSMUSG00000038072
AA Change: T16I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 385 1.7e-10 PFAM
Pfam:Glycos_transf_2 154 337 4.8e-29 PFAM
Pfam:Glyco_transf_7C 314 383 3.5e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114952
AA Change: T16I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110602
Gene: ENSMUSG00000038072
AA Change: T16I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 385 1.7e-10 PFAM
Pfam:Glycos_transf_2 154 337 4.8e-29 PFAM
Pfam:Glyco_transf_7C 314 383 3.5e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144971
Meta Mutation Damage Score 0.5240 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Galnt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Galnt11 APN 5 25,453,829 (GRCm39) splice site probably benign
IGL01553:Galnt11 APN 5 25,452,718 (GRCm39) missense probably benign 0.13
IGL01748:Galnt11 APN 5 25,452,513 (GRCm39) nonsense probably null
R0021:Galnt11 UTSW 5 25,453,855 (GRCm39) missense probably damaging 1.00
R0021:Galnt11 UTSW 5 25,453,855 (GRCm39) missense probably damaging 1.00
R0666:Galnt11 UTSW 5 25,457,145 (GRCm39) missense possibly damaging 0.89
R0784:Galnt11 UTSW 5 25,463,907 (GRCm39) missense probably damaging 1.00
R1136:Galnt11 UTSW 5 25,463,943 (GRCm39) missense probably damaging 0.98
R1168:Galnt11 UTSW 5 25,455,244 (GRCm39) missense probably damaging 1.00
R1617:Galnt11 UTSW 5 25,463,891 (GRCm39) missense probably damaging 1.00
R2507:Galnt11 UTSW 5 25,452,610 (GRCm39) missense probably damaging 1.00
R2508:Galnt11 UTSW 5 25,452,610 (GRCm39) missense probably damaging 1.00
R4237:Galnt11 UTSW 5 25,470,258 (GRCm39) missense probably benign 0.02
R4944:Galnt11 UTSW 5 25,470,336 (GRCm39) missense probably damaging 1.00
R5653:Galnt11 UTSW 5 25,453,856 (GRCm39) missense probably damaging 1.00
R5917:Galnt11 UTSW 5 25,452,670 (GRCm39) splice site probably null
R6489:Galnt11 UTSW 5 25,469,964 (GRCm39) missense probably damaging 0.99
R6696:Galnt11 UTSW 5 25,460,112 (GRCm39) missense probably benign
R6709:Galnt11 UTSW 5 25,453,851 (GRCm39) missense probably damaging 1.00
R6881:Galnt11 UTSW 5 25,455,097 (GRCm39) missense possibly damaging 0.69
R7034:Galnt11 UTSW 5 25,463,811 (GRCm39) missense probably damaging 0.99
R7036:Galnt11 UTSW 5 25,463,811 (GRCm39) missense probably damaging 0.99
R8734:Galnt11 UTSW 5 25,455,222 (GRCm39) missense possibly damaging 0.95
R8992:Galnt11 UTSW 5 25,469,983 (GRCm39) missense possibly damaging 0.81
X0038:Galnt11 UTSW 5 25,462,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCAGGCAAACATGTCAG -3'
(R):5'- CTTTGAACTGTGGATCTAATACCC -3'

Sequencing Primer
(F):5'- GCAGGCAAACATGTCAGCTATTTTG -3'
(R):5'- TGTGGATCTAATACCCGACCTGG -3'
Posted On 2014-08-25