Incidental Mutation 'R1974:Dync1h1'
ID 221471
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Name dynein cytoplasmic 1 heavy chain 1
Synonyms MAP1C, Loa, Dnec1, Dnchc1, dynein heavy chain, retrograde transport, 9930018I23Rik, Swl
MMRRC Submission 039987-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1974 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 110567886-110633379 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110592166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1110 (V1110A)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
AlphaFold no structure available at present
PDB Structure Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018851
AA Change: V1110A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: V1110A

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,773,028 (GRCm39) L739Q probably damaging Het
4933436I01Rik A T X: 66,963,655 (GRCm39) Y401* probably null Het
Abcg3 A G 5: 105,111,504 (GRCm39) V321A probably benign Het
Acad10 C A 5: 121,764,248 (GRCm39) V894L possibly damaging Het
Adam9 A G 8: 25,482,240 (GRCm39) I255T probably damaging Het
Ago3 T C 4: 126,240,544 (GRCm39) Y785C probably damaging Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Akap4 A G X: 6,943,595 (GRCm39) S633G probably benign Het
Alox15 T A 11: 70,240,799 (GRCm39) T194S probably benign Het
Amh T C 10: 80,642,250 (GRCm39) S207P probably benign Het
Apc T A 18: 34,433,057 (GRCm39) C415S possibly damaging Het
Atg14 G A 14: 47,783,298 (GRCm39) R346C probably damaging Het
Atp5mf A T 5: 145,121,389 (GRCm39) L64Q probably damaging Het
Barhl2 C G 5: 106,605,179 (GRCm39) E177Q probably benign Het
C1qtnf5 T C 9: 44,020,072 (GRCm39) V232A probably damaging Het
Calr T C 8: 85,570,786 (GRCm39) I290V probably benign Het
Cdh19 G C 1: 110,817,889 (GRCm39) Q618E possibly damaging Het
Celsr2 G T 3: 108,321,530 (GRCm39) D427E probably damaging Het
Cep250 T C 2: 155,831,424 (GRCm39) S1294P probably damaging Het
Chrna7 T A 7: 62,749,034 (GRCm39) T483S probably damaging Het
Clmn A T 12: 104,758,121 (GRCm39) W132R probably damaging Het
Cpsf2 G A 12: 101,956,306 (GRCm39) D370N probably benign Het
Crnn T C 3: 93,056,594 (GRCm39) V460A probably benign Het
Daam1 T A 12: 72,035,703 (GRCm39) I957N probably damaging Het
Defb9 T C 8: 22,371,905 (GRCm39) K36R probably benign Het
Dock10 T A 1: 80,488,143 (GRCm39) I2007F possibly damaging Het
Dpm1 A T 2: 168,059,667 (GRCm39) V143D probably damaging Het
Erlec1 T G 11: 30,889,604 (GRCm39) K373N possibly damaging Het
Fbxo40 C T 16: 36,790,303 (GRCm39) G269E probably benign Het
Fbxw7 T A 3: 84,862,242 (GRCm39) C70S possibly damaging Het
Fhip2a T C 19: 57,373,809 (GRCm39) F690L probably damaging Het
Fnbp1 G T 2: 30,943,059 (GRCm39) R280S probably null Het
Gapvd1 G A 2: 34,590,853 (GRCm39) R940C probably damaging Het
Gfod2 T C 8: 106,444,142 (GRCm39) K134E possibly damaging Het
Gpi1 A T 7: 33,920,228 (GRCm39) probably null Het
Grik2 A T 10: 49,008,923 (GRCm39) N721K possibly damaging Het
Gsn G T 2: 35,191,483 (GRCm39) G455V probably damaging Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Hpse A G 5: 100,840,104 (GRCm39) S338P probably damaging Het
Hyal2 T C 9: 107,449,371 (GRCm39) C376R probably damaging Het
Inf2 A G 12: 112,574,771 (GRCm39) T781A unknown Het
Iscu A G 5: 113,915,079 (GRCm39) probably benign Het
Kcna4 G A 2: 107,126,565 (GRCm39) G433D possibly damaging Het
Kir3dl2 T A X: 135,357,024 (GRCm39) N146I probably benign Het
Klrg1 T A 6: 122,259,721 (GRCm39) Q17L possibly damaging Het
Krt82 T G 15: 101,453,597 (GRCm39) Q263P probably benign Het
Mfrp T C 9: 44,017,669 (GRCm39) C554R probably damaging Het
Minar1 T G 9: 89,483,256 (GRCm39) T714P probably damaging Het
Mst1r T C 9: 107,791,962 (GRCm39) Y833H probably damaging Het
Mst1r T A 9: 107,793,132 (GRCm39) probably null Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nipal4 T C 11: 46,042,210 (GRCm39) N157S probably damaging Het
Notch2 G A 3: 97,980,071 (GRCm39) G195D probably damaging Het
Nrcam A T 12: 44,610,776 (GRCm39) H492L probably benign Het
Or10aa1 A T 1: 173,870,154 (GRCm39) I213F probably damaging Het
Or4p21 A T 2: 88,276,853 (GRCm39) I143N probably damaging Het
Papln G A 12: 83,828,811 (GRCm39) R817H probably damaging Het
Pcnx2 T C 8: 126,614,110 (GRCm39) E447G probably benign Het
Pdp2 T C 8: 105,320,538 (GRCm39) V129A probably benign Het
Plch2 A G 4: 155,069,410 (GRCm39) F1072S possibly damaging Het
Prag1 T A 8: 36,570,081 (GRCm39) D221E probably damaging Het
Prkg1 T C 19: 31,563,095 (GRCm39) D102G probably damaging Het
Psme4 T A 11: 30,769,011 (GRCm39) D662E probably benign Het
Ptprn T C 1: 75,231,464 (GRCm39) probably null Het
Ptprz1 A G 6: 22,986,310 (GRCm39) D370G probably damaging Het
Qser1 A G 2: 104,590,886 (GRCm39) S1637P probably damaging Het
Sema6a T A 18: 47,403,696 (GRCm39) H642L probably benign Het
Slc30a5 A T 13: 100,950,461 (GRCm39) F209I probably benign Het
Slc4a3 G T 1: 75,528,835 (GRCm39) E508* probably null Het
Stpg2 C T 3: 139,014,944 (GRCm39) R370* probably null Het
Tas2r113 T A 6: 132,870,796 (GRCm39) F275I probably benign Het
Tmem132d T G 5: 128,346,263 (GRCm39) K86N probably damaging Het
Tpgs2 A T 18: 25,273,593 (GRCm39) F189L probably damaging Het
Trmt6 A G 2: 132,652,968 (GRCm39) S104P probably damaging Het
Trpv3 T C 11: 73,174,514 (GRCm39) S294P probably damaging Het
Ugt2b36 A G 5: 87,228,727 (GRCm39) probably null Het
Vmn1r170 A T 7: 23,305,906 (GRCm39) M103L probably benign Het
Vmn2r107 T A 17: 20,575,879 (GRCm39) probably null Het
Vmn2r5 C T 3: 64,411,642 (GRCm39) E309K probably damaging Het
Vmn2r77 T C 7: 86,449,964 (GRCm39) V70A probably benign Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110,615,538 (GRCm39) missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110,580,541 (GRCm39) missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110,592,041 (GRCm39) splice site probably benign
IGL01324:Dync1h1 APN 12 110,593,299 (GRCm39) missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110,583,126 (GRCm39) splice site probably benign
IGL01371:Dync1h1 APN 12 110,605,285 (GRCm39) missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110,624,562 (GRCm39) missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110,581,374 (GRCm39) missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110,625,364 (GRCm39) missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110,618,630 (GRCm39) critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110,603,558 (GRCm39) missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110,599,254 (GRCm39) missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110,628,993 (GRCm39) missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110,629,436 (GRCm39) missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110,607,322 (GRCm39) missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110,606,644 (GRCm39) missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110,625,666 (GRCm39) nonsense probably null
IGL02643:Dync1h1 APN 12 110,625,706 (GRCm39) unclassified probably benign
IGL03076:Dync1h1 APN 12 110,624,327 (GRCm39) missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110,632,989 (GRCm39) splice site probably null
IGL03293:Dync1h1 APN 12 110,595,168 (GRCm39) missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110,585,644 (GRCm39) missense possibly damaging 0.49
chinashop UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
Gesund UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
gymnast UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
Lightfoot UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
Lissom UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
Strong UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
waters UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110,615,538 (GRCm39) missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110,583,241 (GRCm39) missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110,602,880 (GRCm39) missense probably benign
R0110:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110,585,108 (GRCm39) missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110,598,126 (GRCm39) missense probably benign
R0450:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110,599,222 (GRCm39) missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110,582,930 (GRCm39) missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110,618,181 (GRCm39) unclassified probably benign
R0685:Dync1h1 UTSW 12 110,623,626 (GRCm39) missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110,595,718 (GRCm39) missense probably damaging 0.99
R0747:Dync1h1 UTSW 12 110,578,845 (GRCm39) missense probably benign
R0843:Dync1h1 UTSW 12 110,631,647 (GRCm39) missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110,632,393 (GRCm39) missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110,615,698 (GRCm39) missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110,622,791 (GRCm39) missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110,632,096 (GRCm39) critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110,593,426 (GRCm39) missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110,599,362 (GRCm39) splice site probably benign
R1812:Dync1h1 UTSW 12 110,629,334 (GRCm39) missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110,629,059 (GRCm39) missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110,591,070 (GRCm39) missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110,612,738 (GRCm39) missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110,629,063 (GRCm39) missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1999:Dync1h1 UTSW 12 110,632,857 (GRCm39) critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110,581,026 (GRCm39) missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110,616,022 (GRCm39) missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110,596,420 (GRCm39) missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110,607,316 (GRCm39) missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110,623,065 (GRCm39) missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110,607,654 (GRCm39) missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110,609,681 (GRCm39) missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110,583,325 (GRCm39) missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110,607,460 (GRCm39) critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110,607,020 (GRCm39) missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110,609,563 (GRCm39) missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3736:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3882:Dync1h1 UTSW 12 110,595,492 (GRCm39) missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110,632,399 (GRCm39) missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110,609,624 (GRCm39) missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110,584,483 (GRCm39) nonsense probably null
R4355:Dync1h1 UTSW 12 110,599,333 (GRCm39) missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110,623,573 (GRCm39) missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110,615,917 (GRCm39) missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110,605,278 (GRCm39) missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110,595,201 (GRCm39) missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110,628,975 (GRCm39) missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110,621,962 (GRCm39) missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4733:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4780:Dync1h1 UTSW 12 110,627,630 (GRCm39) missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110,606,235 (GRCm39) missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110,629,289 (GRCm39) missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110,584,444 (GRCm39) missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110,593,326 (GRCm39) nonsense probably null
R5036:Dync1h1 UTSW 12 110,596,969 (GRCm39) missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110,607,341 (GRCm39) missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110,584,366 (GRCm39) missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110,596,114 (GRCm39) missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110,595,264 (GRCm39) missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110,581,502 (GRCm39) missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110,599,099 (GRCm39) missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110,627,384 (GRCm39) missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110,607,575 (GRCm39) missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110,632,422 (GRCm39) missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110,595,496 (GRCm39) missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110,612,707 (GRCm39) nonsense probably null
R5806:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110,580,654 (GRCm39) critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110,599,212 (GRCm39) missense probably benign
R6113:Dync1h1 UTSW 12 110,586,848 (GRCm39) missense probably benign
R6119:Dync1h1 UTSW 12 110,594,440 (GRCm39) missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110,584,427 (GRCm39) missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110,612,639 (GRCm39) missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110,583,171 (GRCm39) missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110,616,282 (GRCm39) missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110,624,981 (GRCm39) missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110,618,614 (GRCm39) missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110,590,995 (GRCm39) missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110,605,335 (GRCm39) missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110,632,521 (GRCm39) nonsense probably null
R7096:Dync1h1 UTSW 12 110,623,512 (GRCm39) missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110,568,173 (GRCm39) missense probably benign
R7224:Dync1h1 UTSW 12 110,584,196 (GRCm39) missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110,631,183 (GRCm39) critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110,631,596 (GRCm39) missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110,602,076 (GRCm39) missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110,591,036 (GRCm39) missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110,600,654 (GRCm39) missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110,632,109 (GRCm39) missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110,618,011 (GRCm39) missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110,580,541 (GRCm39) missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110,597,059 (GRCm39) missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110,627,327 (GRCm39) missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110,585,080 (GRCm39) missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110,632,200 (GRCm39) missense probably damaging 1.00
R7808:Dync1h1 UTSW 12 110,621,893 (GRCm39) missense possibly damaging 0.53
R7891:Dync1h1 UTSW 12 110,609,590 (GRCm39) missense probably benign 0.02
R7895:Dync1h1 UTSW 12 110,582,891 (GRCm39) missense probably damaging 1.00
R7913:Dync1h1 UTSW 12 110,595,168 (GRCm39) missense probably benign 0.12
R8164:Dync1h1 UTSW 12 110,582,794 (GRCm39) missense possibly damaging 0.91
R8257:Dync1h1 UTSW 12 110,602,908 (GRCm39) missense probably damaging 1.00
R8346:Dync1h1 UTSW 12 110,632,226 (GRCm39) missense probably benign 0.21
R8432:Dync1h1 UTSW 12 110,584,576 (GRCm39) missense probably benign 0.00
R8510:Dync1h1 UTSW 12 110,583,177 (GRCm39) missense possibly damaging 0.94
R8731:Dync1h1 UTSW 12 110,607,018 (GRCm39) missense possibly damaging 0.93
R8739:Dync1h1 UTSW 12 110,581,014 (GRCm39) missense probably damaging 1.00
R8756:Dync1h1 UTSW 12 110,583,261 (GRCm39) missense probably benign 0.06
R8855:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8866:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8885:Dync1h1 UTSW 12 110,583,172 (GRCm39) missense probably damaging 1.00
R8893:Dync1h1 UTSW 12 110,608,477 (GRCm39) missense probably damaging 1.00
R8913:Dync1h1 UTSW 12 110,624,602 (GRCm39) missense probably benign 0.14
R8937:Dync1h1 UTSW 12 110,584,471 (GRCm39) missense probably damaging 1.00
R8958:Dync1h1 UTSW 12 110,586,805 (GRCm39) missense probably benign 0.00
R9000:Dync1h1 UTSW 12 110,606,397 (GRCm39) missense probably benign
R9036:Dync1h1 UTSW 12 110,606,186 (GRCm39) missense probably benign
R9090:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9108:Dync1h1 UTSW 12 110,622,706 (GRCm39) intron probably benign
R9161:Dync1h1 UTSW 12 110,625,023 (GRCm39) missense probably benign 0.01
R9185:Dync1h1 UTSW 12 110,601,937 (GRCm39) missense probably benign 0.33
R9271:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9436:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9478:Dync1h1 UTSW 12 110,625,137 (GRCm39) missense probably benign 0.02
R9547:Dync1h1 UTSW 12 110,624,805 (GRCm39) missense probably damaging 1.00
R9561:Dync1h1 UTSW 12 110,615,533 (GRCm39) missense probably damaging 0.99
R9586:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9609:Dync1h1 UTSW 12 110,607,362 (GRCm39) missense probably benign 0.01
Z1088:Dync1h1 UTSW 12 110,596,351 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,624,951 (GRCm39) nonsense probably null
Z1177:Dync1h1 UTSW 12 110,607,611 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,603,988 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAAAGAGTTTGGTCCGGTG -3'
(R):5'- TACTGGCTGTGTCAACGGAG -3'

Sequencing Primer
(F):5'- CCGGTGGTGATAGATTACGGC -3'
(R):5'- TGTCAACGGAGTGCTGCTC -3'
Posted On 2014-08-25