Incidental Mutation 'R1974:Inf2'
ID221473
Institutional Source Beutler Lab
Gene Symbol Inf2
Ensembl Gene ENSMUSG00000037679
Gene Nameinverted formin, FH2 and WH2 domain containing
Synonyms2610204M08Rik, EG629699
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1974 (G1)
Quality Score224
Status Not validated
Chromosome12
Chromosomal Location112588784-112615557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112608337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 781 (T781A)
Ref Sequence ENSEMBL: ENSMUSP00000098591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101029]
Predicted Effect unknown
Transcript: ENSMUST00000101029
AA Change: T781A
SMART Domains Protein: ENSMUSP00000098591
Gene: ENSMUSG00000037679
AA Change: T781A

DomainStartEndE-ValueType
Drf_GBD 1 152 3.47e-34 SMART
Drf_FH3 156 343 2.18e-58 SMART
low complexity region 359 382 N/A INTRINSIC
low complexity region 420 518 N/A INTRINSIC
low complexity region 525 557 N/A INTRINSIC
FH2 587 1030 1.96e-53 SMART
WH2 1005 1020 1.68e-2 SMART
Blast:FH2 1049 1179 3e-28 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000222275
AA Change: T238A
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display placental vasculopathy, restricted fetal growth, increased gestational length and transient increase in maternal blood pressure in the late stages of pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Inf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Inf2 APN 12 112611856 nonsense probably null
IGL01582:Inf2 APN 12 112610559 missense unknown
IGL02078:Inf2 APN 12 112601614 missense probably damaging 1.00
IGL02534:Inf2 APN 12 112610496 missense unknown
IGL03122:Inf2 APN 12 112604229 missense probably benign 0.03
IGL03296:Inf2 APN 12 112604208 nonsense probably null
Talon UTSW 12 112610287 splice site probably benign
R0413:Inf2 UTSW 12 112601676 missense probably damaging 1.00
R0552:Inf2 UTSW 12 112612574 intron probably benign
R0920:Inf2 UTSW 12 112610287 splice site probably benign
R1240:Inf2 UTSW 12 112610776 missense unknown
R1452:Inf2 UTSW 12 112601344 missense probably damaging 0.99
R2422:Inf2 UTSW 12 112610824 missense unknown
R3877:Inf2 UTSW 12 112610830 missense unknown
R4108:Inf2 UTSW 12 112607581 missense unknown
R4490:Inf2 UTSW 12 112600204 missense probably damaging 1.00
R5071:Inf2 UTSW 12 112612039 splice site probably null
R5074:Inf2 UTSW 12 112612039 splice site probably null
R5306:Inf2 UTSW 12 112601553 missense probably benign 0.26
R5383:Inf2 UTSW 12 112600145 missense probably damaging 0.99
R5569:Inf2 UTSW 12 112601679 missense possibly damaging 0.80
R5664:Inf2 UTSW 12 112611728 missense unknown
R6157:Inf2 UTSW 12 112604788 unclassified probably benign
R6221:Inf2 UTSW 12 112603745 missense possibly damaging 0.66
R6429:Inf2 UTSW 12 112604256 missense probably benign 0.01
R6955:Inf2 UTSW 12 112610731 missense unknown
R7423:Inf2 UTSW 12 112609738 missense unknown
R7444:Inf2 UTSW 12 112605387 missense unknown
R7496:Inf2 UTSW 12 112600318 missense probably damaging 1.00
R7605:Inf2 UTSW 12 112601337 missense probably damaging 1.00
R7678:Inf2 UTSW 12 112606994 missense unknown
R7708:Inf2 UTSW 12 112607557 missense unknown
R7752:Inf2 UTSW 12 112609684 missense unknown
Predicted Primers PCR Primer
(F):5'- CCATACACCTGCTGAAGCTG -3'
(R):5'- TGTGAGCTTCAGCAAGGTGC -3'

Sequencing Primer
(F):5'- ACCTGCTGAAGCTGAGGGTC -3'
(R):5'- GGTGCTAATCTTGAAACCATCTGC -3'
Posted On2014-08-25