Incidental Mutation 'R2033:Sun1'
ID 221474
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene Name Sad1 and UNC84 domain containing 1
Synonyms 4632417G13Rik, 5730434D03Rik, Unc84a
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 139186392-139235595 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 139211193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 149 (H149Y)
Ref Sequence ENSEMBL: ENSMUSP00000117679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000100517] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000135720] [ENSMUST00000143562] [ENSMUST00000146715] [ENSMUST00000127045] [ENSMUST00000148772] [ENSMUST00000129079]
AlphaFold Q9D666
Predicted Effect probably damaging
Transcript: ENSMUST00000058716
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078690
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100517
AA Change: H149Y

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098086
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110882
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110883
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110884
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135720
AA Change: H55Y

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817
AA Change: H55Y

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
ZnF_C2H2 98 120 5.2e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143562
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116364
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 158 7e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146715
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117679
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 160 4.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153469
Predicted Effect probably benign
Transcript: ENSMUST00000127045
SMART Domains Protein: ENSMUSP00000123211
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148772
SMART Domains Protein: ENSMUSP00000114869
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 64 76 N/A INTRINSIC
Pfam:MRP 103 176 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129079
SMART Domains Protein: ENSMUSP00000119582
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:MRP 71 131 8.6e-19 PFAM
Meta Mutation Damage Score 0.5233 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139,220,440 (GRCm39) critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139,220,496 (GRCm39) missense probably damaging 1.00
IGL02142:Sun1 APN 5 139,216,918 (GRCm39) missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139,227,186 (GRCm39) missense probably damaging 1.00
IGL02939:Sun1 APN 5 139,221,243 (GRCm39) splice site probably benign
IGL03253:Sun1 APN 5 139,209,341 (GRCm39) splice site probably benign
IGL03370:Sun1 APN 5 139,216,886 (GRCm39) missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139,212,343 (GRCm39) missense probably damaging 0.97
R0124:Sun1 UTSW 5 139,232,434 (GRCm39) unclassified probably benign
R0145:Sun1 UTSW 5 139,227,166 (GRCm39) missense probably damaging 0.98
R0376:Sun1 UTSW 5 139,212,454 (GRCm39) unclassified probably benign
R0512:Sun1 UTSW 5 139,220,602 (GRCm39) splice site probably benign
R0729:Sun1 UTSW 5 139,223,619 (GRCm39) unclassified probably benign
R0733:Sun1 UTSW 5 139,216,918 (GRCm39) missense possibly damaging 0.63
R1188:Sun1 UTSW 5 139,224,611 (GRCm39) missense probably damaging 0.98
R1724:Sun1 UTSW 5 139,221,480 (GRCm39) missense probably benign
R1733:Sun1 UTSW 5 139,216,544 (GRCm39) missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139,221,487 (GRCm39) critical splice donor site probably null
R2200:Sun1 UTSW 5 139,216,974 (GRCm39) missense probably benign 0.11
R3084:Sun1 UTSW 5 139,221,356 (GRCm39) missense probably benign 0.41
R3085:Sun1 UTSW 5 139,221,356 (GRCm39) missense probably benign 0.41
R3771:Sun1 UTSW 5 139,224,575 (GRCm39) unclassified probably benign
R3772:Sun1 UTSW 5 139,224,575 (GRCm39) unclassified probably benign
R3804:Sun1 UTSW 5 139,211,117 (GRCm39) nonsense probably null
R4300:Sun1 UTSW 5 139,213,349 (GRCm39) unclassified probably benign
R4428:Sun1 UTSW 5 139,220,230 (GRCm39) intron probably benign
R4993:Sun1 UTSW 5 139,211,088 (GRCm39) missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139,212,646 (GRCm39) splice site probably null
R5363:Sun1 UTSW 5 139,220,498 (GRCm39) missense probably damaging 1.00
R5826:Sun1 UTSW 5 139,231,171 (GRCm39) missense probably damaging 1.00
R6753:Sun1 UTSW 5 139,201,014 (GRCm39) splice site probably null
R7218:Sun1 UTSW 5 139,212,442 (GRCm39) missense unknown
R7320:Sun1 UTSW 5 139,234,239 (GRCm39) missense probably damaging 1.00
R7448:Sun1 UTSW 5 139,232,589 (GRCm39) missense probably damaging 1.00
R7494:Sun1 UTSW 5 139,221,475 (GRCm39) missense probably benign
R8398:Sun1 UTSW 5 139,222,408 (GRCm39) missense probably damaging 1.00
R8756:Sun1 UTSW 5 139,222,444 (GRCm39) missense probably damaging 0.99
R8772:Sun1 UTSW 5 139,209,447 (GRCm39) missense probably benign 0.00
R8804:Sun1 UTSW 5 139,216,920 (GRCm39) missense probably benign 0.05
R8924:Sun1 UTSW 5 139,209,390 (GRCm39) missense probably damaging 1.00
R9124:Sun1 UTSW 5 139,231,121 (GRCm39) nonsense probably null
R9169:Sun1 UTSW 5 139,219,273 (GRCm39) missense probably benign 0.33
R9262:Sun1 UTSW 5 139,200,918 (GRCm39) missense unknown
R9558:Sun1 UTSW 5 139,211,019 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGTAGGACAGTCAAACAGAG -3'
(R):5'- GAATGGCTGTAAGACTGCTGC -3'

Sequencing Primer
(F):5'- CAGTCAAACAGAGAAGAAGTGC -3'
(R):5'- AATCAGCCATGTTTCAGAGAGC -3'
Posted On 2014-08-25