Incidental Mutation 'R2033:Gars'
ID221476
Institutional Source Beutler Lab
Gene Symbol Gars
Ensembl Gene ENSMUSG00000029777
Gene Nameglycyl-tRNA synthetase
SynonymsGENA202, Sgrp23, Gena201
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55038007-55079500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55077723 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 672 (H672Y)
Ref Sequence ENSEMBL: ENSMUSP00000003572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003572]
Predicted Effect probably benign
Transcript: ENSMUST00000003572
AA Change: H672Y

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000003572
Gene: ENSMUSG00000029777
AA Change: H672Y

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
WHEP-TRS 57 112 1.58e-8 SMART
Pfam:tRNA-synt_2b 281 582 2.1e-10 PFAM
Pfam:HGTP_anticodon 605 699 7.7e-24 PFAM
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: A dominant mutation results in sensory and motor axon degeneration in affected mice, with defects in synaptic transmission, nerve conduction and premature death. A loss of function mutation results in embryonic lethality in homozygous mice, and no discernable phenotype in heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Gars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gars APN 6 55050353 missense probably damaging 1.00
IGL01084:Gars APN 6 55055827 missense probably benign
IGL01514:Gars APN 6 55065520 missense probably benign 0.01
IGL02104:Gars APN 6 55077697 missense probably damaging 1.00
IGL02349:Gars APN 6 55048064 splice site probably benign
IGL02371:Gars APN 6 55065467 missense probably benign 0.08
IGL02932:Gars APN 6 55060944 missense probably damaging 1.00
IGL02799:Gars UTSW 6 55063099 missense probably damaging 1.00
R0637:Gars UTSW 6 55069487 critical splice donor site probably null
R0762:Gars UTSW 6 55077580 splice site probably null
R1451:Gars UTSW 6 55053123 splice site probably benign
R1846:Gars UTSW 6 55063168 missense probably benign 0.05
R1988:Gars UTSW 6 55077772 missense probably null 0.00
R2566:Gars UTSW 6 55065563 missense probably damaging 1.00
R4706:Gars UTSW 6 55069378 missense probably damaging 0.99
R4854:Gars UTSW 6 55046418 missense probably damaging 0.99
R5055:Gars UTSW 6 55068092 missense probably damaging 1.00
R5558:Gars UTSW 6 55065607 missense probably damaging 1.00
R6306:Gars UTSW 6 55055824 missense probably damaging 1.00
R6821:Gars UTSW 6 55079338 missense probably benign 0.00
R7376:Gars UTSW 6 55073359 missense probably benign 0.00
R7505:Gars UTSW 6 55052177 missense probably benign 0.00
R7579:Gars UTSW 6 55077703 missense probably damaging 1.00
R7605:Gars UTSW 6 55077750 missense probably damaging 1.00
R7728:Gars UTSW 6 55050386 missense probably damaging 1.00
R8014:Gars UTSW 6 55073407 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCGTTCAGATGACACTGAG -3'
(R):5'- ACAGTTCTGGGAATCTGGGC -3'

Sequencing Primer
(F):5'- GCGTTCAGATGACACTGAGAATTAC -3'
(R):5'- GGAATCTGGGCTTTGTCTGATAC -3'
Posted On2014-08-25