Incidental Mutation 'R2033:Gars1'
ID 221476
Institutional Source Beutler Lab
Gene Symbol Gars1
Ensembl Gene ENSMUSG00000029777
Gene Name glycyl-tRNA synthetase 1
Synonyms Gena201, Sgrp23, Gars, GENA202
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 55014992-55056485 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55054708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 672 (H672Y)
Ref Sequence ENSEMBL: ENSMUSP00000003572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003572]
AlphaFold Q9CZD3
Predicted Effect probably benign
Transcript: ENSMUST00000003572
AA Change: H672Y

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000003572
Gene: ENSMUSG00000029777
AA Change: H672Y

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
WHEP-TRS 57 112 1.58e-8 SMART
Pfam:tRNA-synt_2b 281 582 2.1e-10 PFAM
Pfam:HGTP_anticodon 605 699 7.7e-24 PFAM
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: A dominant mutation results in sensory and motor axon degeneration in affected mice, with defects in synaptic transmission, nerve conduction and premature death. A loss of function mutation results in embryonic lethality in homozygous mice, and no discernable phenotype in heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Gars1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gars1 APN 6 55,027,338 (GRCm39) missense probably damaging 1.00
IGL01084:Gars1 APN 6 55,032,812 (GRCm39) missense probably benign
IGL01514:Gars1 APN 6 55,042,505 (GRCm39) missense probably benign 0.01
IGL02104:Gars1 APN 6 55,054,682 (GRCm39) missense probably damaging 1.00
IGL02349:Gars1 APN 6 55,025,049 (GRCm39) splice site probably benign
IGL02371:Gars1 APN 6 55,042,452 (GRCm39) missense probably benign 0.08
IGL02932:Gars1 APN 6 55,037,929 (GRCm39) missense probably damaging 1.00
BB006:Gars1 UTSW 6 55,040,102 (GRCm39) missense probably damaging 1.00
BB016:Gars1 UTSW 6 55,040,102 (GRCm39) missense probably damaging 1.00
IGL02799:Gars1 UTSW 6 55,040,084 (GRCm39) missense probably damaging 1.00
R0637:Gars1 UTSW 6 55,046,472 (GRCm39) critical splice donor site probably null
R0762:Gars1 UTSW 6 55,054,565 (GRCm39) splice site probably null
R1451:Gars1 UTSW 6 55,030,108 (GRCm39) splice site probably benign
R1846:Gars1 UTSW 6 55,040,153 (GRCm39) missense probably benign 0.05
R1988:Gars1 UTSW 6 55,054,757 (GRCm39) missense probably null 0.00
R2566:Gars1 UTSW 6 55,042,548 (GRCm39) missense probably damaging 1.00
R4706:Gars1 UTSW 6 55,046,363 (GRCm39) missense probably damaging 0.99
R4854:Gars1 UTSW 6 55,023,403 (GRCm39) missense probably damaging 0.99
R5055:Gars1 UTSW 6 55,045,077 (GRCm39) missense probably damaging 1.00
R5558:Gars1 UTSW 6 55,042,592 (GRCm39) missense probably damaging 1.00
R6306:Gars1 UTSW 6 55,032,809 (GRCm39) missense probably damaging 1.00
R6821:Gars1 UTSW 6 55,056,323 (GRCm39) missense probably benign 0.00
R7376:Gars1 UTSW 6 55,050,344 (GRCm39) missense probably benign 0.00
R7505:Gars1 UTSW 6 55,029,162 (GRCm39) missense probably benign 0.00
R7579:Gars1 UTSW 6 55,054,688 (GRCm39) missense probably damaging 1.00
R7605:Gars1 UTSW 6 55,054,735 (GRCm39) missense probably damaging 1.00
R7728:Gars1 UTSW 6 55,027,371 (GRCm39) missense probably damaging 1.00
R7929:Gars1 UTSW 6 55,040,102 (GRCm39) missense probably damaging 1.00
R8014:Gars1 UTSW 6 55,050,392 (GRCm39) missense probably benign
R8391:Gars1 UTSW 6 55,025,127 (GRCm39) missense probably damaging 1.00
R8418:Gars1 UTSW 6 55,042,446 (GRCm39) missense probably damaging 0.99
R8704:Gars1 UTSW 6 55,040,215 (GRCm39) missense probably damaging 0.98
R9350:Gars1 UTSW 6 55,029,249 (GRCm39) missense probably null 0.57
Predicted Primers PCR Primer
(F):5'- TGCGTTCAGATGACACTGAG -3'
(R):5'- ACAGTTCTGGGAATCTGGGC -3'

Sequencing Primer
(F):5'- GCGTTCAGATGACACTGAGAATTAC -3'
(R):5'- GGAATCTGGGCTTTGTCTGATAC -3'
Posted On 2014-08-25