Incidental Mutation 'R2033:Pdzrn3'
ID221480
Institutional Source Beutler Lab
Gene Symbol Pdzrn3
Ensembl Gene ENSMUSG00000035357
Gene NamePDZ domain containing RING finger 3
SynonymsLNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location101149609-101377897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101150954 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 917 (E917G)
Ref Sequence ENSEMBL: ENSMUSP00000075376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075994]
Predicted Effect probably damaging
Transcript: ENSMUST00000075994
AA Change: E917G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: E917G

DomainStartEndE-ValueType
RING 18 55 3.93e-3 SMART
low complexity region 198 214 N/A INTRINSIC
PDZ 257 339 3.38e-21 SMART
PDZ 429 504 3.86e-16 SMART
low complexity region 512 526 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 1020 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205008
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Pdzrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Pdzrn3 APN 6 101354486 missense probably benign 0.01
IGL01511:Pdzrn3 APN 6 101153256 missense possibly damaging 0.66
IGL01554:Pdzrn3 APN 6 101150541 missense probably damaging 1.00
IGL02450:Pdzrn3 APN 6 101354500 missense probably damaging 1.00
IGL02505:Pdzrn3 APN 6 101151938 missense possibly damaging 0.94
IGL03061:Pdzrn3 APN 6 101151855 missense probably damaging 1.00
IGL03210:Pdzrn3 APN 6 101156952 missense possibly damaging 0.95
gefilte UTSW 6 101154192 critical splice donor site probably null
implevit_bonis UTSW 6 101151022 missense probably benign 0.15
predisposition UTSW 6 101151053 missense probably damaging 1.00
tendency UTSW 6 101151428 missense probably damaging 1.00
PIT4581001:Pdzrn3 UTSW 6 101151503 missense probably benign 0.00
R0110:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0469:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0496:Pdzrn3 UTSW 6 101150570 missense possibly damaging 0.94
R0510:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0883:Pdzrn3 UTSW 6 101155942 splice site probably null
R1171:Pdzrn3 UTSW 6 101150877 missense probably damaging 1.00
R1471:Pdzrn3 UTSW 6 101151512 missense possibly damaging 0.77
R1496:Pdzrn3 UTSW 6 101150969 missense probably benign 0.00
R1596:Pdzrn3 UTSW 6 101151005 missense probably benign 0.03
R2068:Pdzrn3 UTSW 6 101150699 missense probably damaging 1.00
R2084:Pdzrn3 UTSW 6 101154295 missense probably benign 0.35
R2432:Pdzrn3 UTSW 6 101150791 missense probably damaging 1.00
R3727:Pdzrn3 UTSW 6 101156945 missense probably damaging 0.98
R3861:Pdzrn3 UTSW 6 101172371 missense possibly damaging 0.95
R4616:Pdzrn3 UTSW 6 101152009 missense probably damaging 0.99
R4967:Pdzrn3 UTSW 6 101151590 missense probably damaging 1.00
R5224:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5226:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5227:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5230:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5320:Pdzrn3 UTSW 6 101151103 missense probably damaging 1.00
R5414:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5686:Pdzrn3 UTSW 6 101151428 missense probably damaging 1.00
R5772:Pdzrn3 UTSW 6 101172314 missense probably benign 0.00
R6026:Pdzrn3 UTSW 6 101362144 missense probably benign 0.40
R6213:Pdzrn3 UTSW 6 101377844 missense probably damaging 1.00
R6518:Pdzrn3 UTSW 6 101150514 makesense probably null
R6657:Pdzrn3 UTSW 6 101151022 missense probably benign 0.15
R6951:Pdzrn3 UTSW 6 101154192 critical splice donor site probably null
R7055:Pdzrn3 UTSW 6 101151774 nonsense probably null
R7290:Pdzrn3 UTSW 6 101151245 missense probably benign
R7608:Pdzrn3 UTSW 6 101151752 missense probably damaging 1.00
R7834:Pdzrn3 UTSW 6 101151195 missense probably damaging 0.97
R7917:Pdzrn3 UTSW 6 101151195 missense probably damaging 0.97
Z1176:Pdzrn3 UTSW 6 101151999 missense not run
Predicted Primers PCR Primer
(F):5'- AGATGTTGCTTGCGCTCCTC -3'
(R):5'- TCAAAGAACGCCGAGGTAGC -3'

Sequencing Primer
(F):5'- GCTCCTCCTTGCTCCAGTAG -3'
(R):5'- GGCAATGCCTACCTGCC -3'
Posted On2014-08-25