Incidental Mutation 'R2033:Pdzrn3'
ID 221480
Institutional Source Beutler Lab
Gene Symbol Pdzrn3
Ensembl Gene ENSMUSG00000035357
Gene Name PDZ domain containing RING finger 3
Synonyms 1110020C07Rik, semaphorin cytoplasmic domain-associated protein 3A, LNX3, Semcap3
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.780) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 101126570-101354858 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101127915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 917 (E917G)
Ref Sequence ENSEMBL: ENSMUSP00000075376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075994]
AlphaFold Q69ZS0
Predicted Effect probably damaging
Transcript: ENSMUST00000075994
AA Change: E917G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: E917G

DomainStartEndE-ValueType
RING 18 55 3.93e-3 SMART
low complexity region 198 214 N/A INTRINSIC
PDZ 257 339 3.38e-21 SMART
PDZ 429 504 3.86e-16 SMART
low complexity region 512 526 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 1020 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205008
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Pdzrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Pdzrn3 APN 6 101,331,447 (GRCm39) missense probably benign 0.01
IGL01511:Pdzrn3 APN 6 101,130,217 (GRCm39) missense possibly damaging 0.66
IGL01554:Pdzrn3 APN 6 101,127,502 (GRCm39) missense probably damaging 1.00
IGL02450:Pdzrn3 APN 6 101,331,461 (GRCm39) missense probably damaging 1.00
IGL02505:Pdzrn3 APN 6 101,128,899 (GRCm39) missense possibly damaging 0.94
IGL03061:Pdzrn3 APN 6 101,128,816 (GRCm39) missense probably damaging 1.00
IGL03210:Pdzrn3 APN 6 101,133,913 (GRCm39) missense possibly damaging 0.95
gefilte UTSW 6 101,131,153 (GRCm39) critical splice donor site probably null
implevit_bonis UTSW 6 101,127,983 (GRCm39) missense probably benign 0.15
predisposition UTSW 6 101,128,014 (GRCm39) missense probably damaging 1.00
tendency UTSW 6 101,128,389 (GRCm39) missense probably damaging 1.00
PIT4581001:Pdzrn3 UTSW 6 101,128,464 (GRCm39) missense probably benign 0.00
R0110:Pdzrn3 UTSW 6 101,128,014 (GRCm39) missense probably damaging 1.00
R0469:Pdzrn3 UTSW 6 101,128,014 (GRCm39) missense probably damaging 1.00
R0496:Pdzrn3 UTSW 6 101,127,531 (GRCm39) missense possibly damaging 0.94
R0510:Pdzrn3 UTSW 6 101,128,014 (GRCm39) missense probably damaging 1.00
R0883:Pdzrn3 UTSW 6 101,132,903 (GRCm39) splice site probably null
R1171:Pdzrn3 UTSW 6 101,127,838 (GRCm39) missense probably damaging 1.00
R1471:Pdzrn3 UTSW 6 101,128,473 (GRCm39) missense possibly damaging 0.77
R1496:Pdzrn3 UTSW 6 101,127,930 (GRCm39) missense probably benign 0.00
R1596:Pdzrn3 UTSW 6 101,127,966 (GRCm39) missense probably benign 0.03
R2068:Pdzrn3 UTSW 6 101,127,660 (GRCm39) missense probably damaging 1.00
R2084:Pdzrn3 UTSW 6 101,131,256 (GRCm39) missense probably benign 0.35
R2432:Pdzrn3 UTSW 6 101,127,752 (GRCm39) missense probably damaging 1.00
R3727:Pdzrn3 UTSW 6 101,133,906 (GRCm39) missense probably damaging 0.98
R3861:Pdzrn3 UTSW 6 101,149,332 (GRCm39) missense possibly damaging 0.95
R4616:Pdzrn3 UTSW 6 101,128,970 (GRCm39) missense probably damaging 0.99
R4967:Pdzrn3 UTSW 6 101,128,551 (GRCm39) missense probably damaging 1.00
R5224:Pdzrn3 UTSW 6 101,130,272 (GRCm39) missense probably damaging 1.00
R5226:Pdzrn3 UTSW 6 101,130,272 (GRCm39) missense probably damaging 1.00
R5227:Pdzrn3 UTSW 6 101,130,272 (GRCm39) missense probably damaging 1.00
R5230:Pdzrn3 UTSW 6 101,130,272 (GRCm39) missense probably damaging 1.00
R5320:Pdzrn3 UTSW 6 101,128,064 (GRCm39) missense probably damaging 1.00
R5414:Pdzrn3 UTSW 6 101,130,272 (GRCm39) missense probably damaging 1.00
R5686:Pdzrn3 UTSW 6 101,128,389 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn3 UTSW 6 101,149,275 (GRCm39) missense probably benign 0.00
R6026:Pdzrn3 UTSW 6 101,339,105 (GRCm39) missense probably benign 0.40
R6213:Pdzrn3 UTSW 6 101,354,805 (GRCm39) missense probably damaging 1.00
R6518:Pdzrn3 UTSW 6 101,127,475 (GRCm39) makesense probably null
R6657:Pdzrn3 UTSW 6 101,127,983 (GRCm39) missense probably benign 0.15
R6951:Pdzrn3 UTSW 6 101,131,153 (GRCm39) critical splice donor site probably null
R7055:Pdzrn3 UTSW 6 101,128,735 (GRCm39) nonsense probably null
R7290:Pdzrn3 UTSW 6 101,128,206 (GRCm39) missense probably benign
R7608:Pdzrn3 UTSW 6 101,128,713 (GRCm39) missense probably damaging 1.00
R7834:Pdzrn3 UTSW 6 101,128,156 (GRCm39) missense probably damaging 0.97
R8199:Pdzrn3 UTSW 6 101,128,918 (GRCm39) missense probably damaging 1.00
R8338:Pdzrn3 UTSW 6 101,127,783 (GRCm39) missense probably benign 0.00
R8734:Pdzrn3 UTSW 6 101,128,567 (GRCm39) missense probably damaging 0.98
R8783:Pdzrn3 UTSW 6 101,132,841 (GRCm39) missense probably damaging 1.00
R9082:Pdzrn3 UTSW 6 101,146,094 (GRCm39) critical splice donor site probably null
R9378:Pdzrn3 UTSW 6 101,127,772 (GRCm39) missense probably damaging 1.00
R9499:Pdzrn3 UTSW 6 101,127,855 (GRCm39) missense probably damaging 1.00
R9542:Pdzrn3 UTSW 6 101,149,235 (GRCm39) missense probably benign 0.00
R9551:Pdzrn3 UTSW 6 101,127,855 (GRCm39) missense probably damaging 1.00
R9639:Pdzrn3 UTSW 6 101,146,172 (GRCm39) missense probably benign 0.00
R9743:Pdzrn3 UTSW 6 101,354,678 (GRCm39) missense probably damaging 1.00
Z1176:Pdzrn3 UTSW 6 101,128,960 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTTGCTTGCGCTCCTC -3'
(R):5'- TCAAAGAACGCCGAGGTAGC -3'

Sequencing Primer
(F):5'- GCTCCTCCTTGCTCCAGTAG -3'
(R):5'- GGCAATGCCTACCTGCC -3'
Posted On 2014-08-25