Incidental Mutation 'R1974:Aif1'
ID221487
Institutional Source Beutler Lab
Gene Symbol Aif1
Ensembl Gene ENSMUSG00000024397
Gene Nameallograft inflammatory factor 1
SynonymsD17H6S50E, Iba1, G1
MMRRC Submission 039987-MU
Accession Numbers

Genbank: NM_019467; MGI: 1343098

Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R1974 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35170991-35176068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35172151 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000134107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025257] [ENSMUST00000172693] [ENSMUST00000173106] [ENSMUST00000173324]
Predicted Effect probably benign
Transcript: ENSMUST00000025257
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025257
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172679
Predicted Effect probably benign
Transcript: ENSMUST00000172693
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134214
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173106
AA Change: P44L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134107
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 128 4e-47 PDB
Blast:EFh 98 122 4e-9 BLAST
SCOP:d1mr8a_ 98 128 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173281
Predicted Effect probably benign
Transcript: ENSMUST00000173324
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133709
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174044
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased spleen weight, decreased platalet cell number and decreased susceptibility to induced arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Aif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Aif1 APN 17 35171555 missense probably damaging 1.00
IGL03279:Aif1 APN 17 35171547 nonsense probably null
N/A:Aif1 UTSW 17 35172520 missense possibly damaging 0.83
R0396:Aif1 UTSW 17 35171109 makesense probably null
R1062:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1063:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1064:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1105:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1122:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1154:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1286:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1447:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1678:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1689:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1750:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1911:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2314:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2338:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2341:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2915:Aif1 UTSW 17 35172151 missense probably benign 0.01
R4953:Aif1 UTSW 17 35171098 unclassified probably null
R5260:Aif1 UTSW 17 35171941 critical splice acceptor site probably null
R6786:Aif1 UTSW 17 35171496 missense probably damaging 1.00
R7503:Aif1 UTSW 17 35171573 missense probably damaging 1.00
R7534:Aif1 UTSW 17 35171414 missense possibly damaging 0.77
R7891:Aif1 UTSW 17 35172624 start gained probably benign
R7974:Aif1 UTSW 17 35172624 start gained probably benign
Y4338:Aif1 UTSW 17 35172151 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGGTGGCTGAGCAATGC -3'
(R):5'- GCTTTTGGACTGCTGAAGGC -3'

Sequencing Primer
(F):5'- CTGAGCAATGCCAGGGTAG -3'
(R):5'- CTGAAGGCCCAGCAGGAAG -3'
Posted On2014-08-25