Incidental Mutation 'R2033:Or51h5'
ID 221488
Institutional Source Beutler Lab
Gene Symbol Or51h5
Ensembl Gene ENSMUSG00000073963
Gene Name olfactory receptor family 51 subfamily H member 5
Synonyms MOR10-2, GA_x6K02T2PBJ9-5638785-5639741, Olfr572
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 102576837-102577793 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102577615 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 260 (V260A)
Ref Sequence ENSEMBL: ENSMUSP00000149174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098214] [ENSMUST00000214096] [ENSMUST00000215782]
AlphaFold Q8VGZ3
Predicted Effect probably benign
Transcript: ENSMUST00000098214
AA Change: V260A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095816
Gene: ENSMUSG00000073963
AA Change: V260A

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 37 309 2e-7 PFAM
Pfam:7tm_1 43 294 1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214096
AA Change: V260A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000215782
AA Change: V260A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Or51h5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Or51h5 APN 7 102,577,623 (GRCm39) missense probably benign 0.03
IGL02015:Or51h5 APN 7 102,577,399 (GRCm39) missense probably benign 0.06
IGL02466:Or51h5 APN 7 102,577,723 (GRCm39) missense possibly damaging 0.88
R0632:Or51h5 UTSW 7 102,577,811 (GRCm39) splice site probably null
R1852:Or51h5 UTSW 7 102,577,648 (GRCm39) missense probably damaging 1.00
R2679:Or51h5 UTSW 7 102,577,238 (GRCm39) nonsense probably null
R4520:Or51h5 UTSW 7 102,577,764 (GRCm39) missense probably benign
R4596:Or51h5 UTSW 7 102,577,458 (GRCm39) missense possibly damaging 0.74
R5538:Or51h5 UTSW 7 102,577,728 (GRCm39) missense probably damaging 1.00
R6477:Or51h5 UTSW 7 102,577,585 (GRCm39) missense probably damaging 1.00
R7028:Or51h5 UTSW 7 102,577,149 (GRCm39) missense probably damaging 1.00
R8034:Or51h5 UTSW 7 102,577,773 (GRCm39) nonsense probably null
R9421:Or51h5 UTSW 7 102,577,711 (GRCm39) missense probably damaging 1.00
Z1177:Or51h5 UTSW 7 102,576,851 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGTCAACAGTCTCTATGGC -3'
(R):5'- GTTTCTTGCTCTCTCAAAACAGG -3'

Sequencing Primer
(F):5'- AACAGTCTCTATGGCCTTATAGCTG -3'
(R):5'- CTTGCTCTCTCAAAACAGGTTTTAAC -3'
Posted On 2014-08-25