Mutagenetix > Incidental Mutations

Incidental Mutation 'R1974:Apc'

221491

Institutional Source

Beutler Lab

Gene Symbol

Apc

Ensembl Gene

ENSMUSG00000005871

Gene Name

adenomatosis polyposis coli

Synonyms

CC1, Min

MMRRC Submission

039987-MU

Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R1974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34220924-34322189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34300004 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 415 (C415S)

Ref Sequence

ENSEMBL: ENSMUSP00000111447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079362
AA Change: C449S

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: C449S

Domain	Start	End	E-Value	Type
Pfam:APC_N_CC	4	55	6e-32	PFAM
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	125	205	2e-24	PFAM
low complexity region	211	222	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
ARM	338	390	6.14e-5	SMART
ARM	457	508	1.62e-4	SMART
ARM	510	551	8.56e-4	SMART
ARM	554	595	4.45e-2	SMART
ARM	597	642	5.76e1	SMART
ARM	647	687	1.29e-7	SMART
Pfam:Arm_APC_u3	730	1017	5e-170	PFAM
Pfam:APC_15aa	1018	1032	1.1e-8	PFAM
Pfam:APC_u5	1034	1133	7.6e-55	PFAM
Pfam:APC_15aa	1154	1168	1.6e-8	PFAM
Pfam:APC_15aa	1171	1185	1.9e-9	PFAM
low complexity region	1187	1204	N/A	INTRINSIC
Pfam:APC_crr	1255	1279	1.5e-15	PFAM
Pfam:APC_u9	1280	1367	1.9e-34	PFAM
Pfam:APC_crr	1370	1393	2.2e-10	PFAM
low complexity region	1431	1449	N/A	INTRINSIC
Pfam:APC_crr	1485	1509	2.1e-9	PFAM
low complexity region	1532	1548	N/A	INTRINSIC
Pfam:SAMP	1568	1587	2.7e-11	PFAM
Pfam:APC_crr	1635	1659	1.9e-15	PFAM
Pfam:APC_u13	1660	1716	1.3e-31	PFAM
Pfam:SAMP	1717	1736	3.2e-12	PFAM
Pfam:APC_u14	1737	1837	1e-46	PFAM
Pfam:APC_crr	1839	1864	6.8e-15	PFAM
Pfam:APC_u15	1865	1945	1.8e-40	PFAM
Pfam:APC_crr	1947	1971	1.6e-14	PFAM
Pfam:APC_crr	2007	2030	1.8e-14	PFAM
Pfam:SAMP	2033	2052	1.6e-13	PFAM
low complexity region	2112	2146	N/A	INTRINSIC
Pfam:APC_basic	2223	2579	1.5e-110	PFAM
low complexity region	2626	2638	N/A	INTRINSIC
Pfam:EB1_binding	2670	2842	9.3e-89	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115781
AA Change: C415S

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: C415S

Domain	Start	End	E-Value	Type
PDB:1DEB\|B	2	55	1e-27	PDB
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	124	206	1.5e-31	PFAM
low complexity region	211	222	N/A	INTRINSIC
ARM	304	356	6.14e-5	SMART
ARM	423	474	1.62e-4	SMART
ARM	476	517	8.56e-4	SMART
ARM	520	561	4.45e-2	SMART
ARM	563	608	5.76e1	SMART
ARM	613	653	1.29e-7	SMART
Pfam:Arm	655	695	1.7e-6	PFAM
low complexity region	797	810	N/A	INTRINSIC
low complexity region	880	892	N/A	INTRINSIC
low complexity region	923	935	N/A	INTRINSIC
Pfam:APC_15aa	984	999	3.7e-9	PFAM
Pfam:APC_15aa	1100	1115	8.4e-8	PFAM
Pfam:APC_15aa	1120	1135	9.9e-9	PFAM
Pfam:APC_15aa	1137	1152	1.2e-9	PFAM
low complexity region	1153	1170	N/A	INTRINSIC
Pfam:APC_crr	1220	1245	7.5e-15	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
Pfam:APC_crr	1334	1359	2.8e-11	PFAM
low complexity region	1397	1415	N/A	INTRINSIC
Pfam:APC_crr	1450	1475	2.2e-8	PFAM
low complexity region	1498	1514	N/A	INTRINSIC
Pfam:SAMP	1533	1553	8.4e-12	PFAM
Pfam:APC_crr	1600	1625	3.5e-13	PFAM
Pfam:SAMP	1682	1702	5e-12	PFAM
low complexity region	1732	1744	N/A	INTRINSIC
Pfam:APC_crr	1805	1830	3.1e-12	PFAM
low complexity region	1866	1877	N/A	INTRINSIC
Pfam:APC_crr	1912	1937	3.5e-13	PFAM
Pfam:APC_crr	1971	1996	7.1e-14	PFAM
Pfam:SAMP	1999	2018	4.6e-13	PFAM
low complexity region	2078	2112	N/A	INTRINSIC
Pfam:APC_basic	2189	2545	1.1e-131	PFAM
low complexity region	2592	2604	N/A	INTRINSIC
Pfam:EB1_binding	2636	2808	2.9e-90	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000165590
AA Change: C13S

SMART Domains

Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871
AA Change: C13S

Domain	Start	End	E-Value	Type
PDB:3AU3\|A	2	33	2e-17	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170023

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171187
AA Change: C431S

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871
AA Change: C431S

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
low complexity region	23	52	N/A	INTRINSIC
low complexity region	102	119	N/A	INTRINSIC
Pfam:Suppressor_APC	134	216	5.2e-32	PFAM
ARM	320	372	6.14e-5	SMART
ARM	439	490	1.62e-4	SMART
ARM	492	533	8.56e-4	SMART
ARM	536	577	4.45e-2	SMART
ARM	579	624	5.76e1	SMART
ARM	629	669	1.29e-7	SMART
Pfam:Arm	671	711	6.3e-7	PFAM
low complexity region	813	826	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
Pfam:APC_15aa	1000	1015	1.4e-9	PFAM
Pfam:APC_15aa	1116	1131	3.1e-8	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]

Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,267	L739Q	probably damaging	Het
4933436I01Rik	A	T	X: 67,920,049	Y401*	probably null	Het
Abcg3	A	G	5: 104,963,638	V321A	probably benign	Het
Acad10	C	A	5: 121,626,185	V894L	possibly damaging	Het
Adam9	A	G	8: 24,992,224	I255T	probably damaging	Het
AF529169	T	G	9: 89,601,203	T714P	probably damaging	Het
Ago3	T	C	4: 126,346,751	Y785C	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Akap4	A	G	X: 7,077,356	S633G	probably benign	Het
Alox15	T	A	11: 70,349,973	T194S	probably benign	Het
Amh	T	C	10: 80,806,416	S207P	probably benign	Het
Atg14	G	A	14: 47,545,841	R346C	probably damaging	Het
Atp5j2	A	T	5: 145,184,579	L64Q	probably damaging	Het
Barhl2	C	G	5: 106,457,313	E177Q	probably benign	Het
C1qtnf5	T	C	9: 44,108,775	V232A	probably damaging	Het
Calr	T	C	8: 84,844,157	I290V	probably benign	Het
Cdh19	G	C	1: 110,890,159	Q618E	possibly damaging	Het
Celsr2	G	T	3: 108,414,214	D427E	probably damaging	Het
Cep250	T	C	2: 155,989,504	S1294P	probably damaging	Het
Chrna7	T	A	7: 63,099,286	T483S	probably damaging	Het
Clmn	A	T	12: 104,791,862	W132R	probably damaging	Het
Cpsf2	G	A	12: 101,990,047	D370N	probably benign	Het
Crnn	T	C	3: 93,149,287	V460A	probably benign	Het
Daam1	T	A	12: 71,988,929	I957N	probably damaging	Het
Defb9	T	C	8: 21,881,889	K36R	probably benign	Het
Dock10	T	A	1: 80,510,426	I2007F	possibly damaging	Het
Dpm1	A	T	2: 168,217,747	V143D	probably damaging	Het
Dync1h1	T	C	12: 110,625,732	V1110A	possibly damaging	Het
Erlec1	T	G	11: 30,939,604	K373N	possibly damaging	Het
Fam160b1	T	C	19: 57,385,377	F690L	probably damaging	Het
Fbxo40	C	T	16: 36,969,941	G269E	probably benign	Het
Fbxw7	T	A	3: 84,954,935	C70S	possibly damaging	Het
Fnbp1	G	T	2: 31,053,047	R280S	probably null	Het
Gapvd1	G	A	2: 34,700,841	R940C	probably damaging	Het
Gfod2	T	C	8: 105,717,510	K134E	possibly damaging	Het
Gm13757	A	T	2: 88,446,509	I143N	probably damaging	Het
Gpi1	A	T	7: 34,220,803		probably null	Het
Grik2	A	T	10: 49,132,827	N721K	possibly damaging	Het
Gsn	G	T	2: 35,301,471	G455V	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Hpse	A	G	5: 100,692,238	S338P	probably damaging	Het
Hyal2	T	C	9: 107,572,172	C376R	probably damaging	Het
Inf2	A	G	12: 112,608,337	T781A	unknown	Het
Iscu	A	G	5: 113,777,018		probably benign	Het
Kcna4	G	A	2: 107,296,220	G433D	possibly damaging	Het
Kir3dl2	T	A	X: 136,456,275	N146I	probably benign	Het
Klrg1	T	A	6: 122,282,762	Q17L	possibly damaging	Het
Krt82	T	G	15: 101,545,162	Q263P	probably benign	Het
Mfrp	T	C	9: 44,106,372	C554R	probably damaging	Het
Mst1r	T	C	9: 107,914,763	Y833H	probably damaging	Het
Mst1r	T	A	9: 107,915,933		probably null	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nipal4	T	C	11: 46,151,383	N157S	probably damaging	Het
Notch2	G	A	3: 98,072,755	G195D	probably damaging	Het
Nrcam	A	T	12: 44,563,993	H492L	probably benign	Het
Olfr433	A	T	1: 174,042,588	I213F	probably damaging	Het
Papln	G	A	12: 83,782,037	R817H	probably damaging	Het
Pcnx2	T	C	8: 125,887,371	E447G	probably benign	Het
Pdp2	T	C	8: 104,593,906	V129A	probably benign	Het
Plch2	A	G	4: 154,984,953	F1072S	possibly damaging	Het
Prag1	T	A	8: 36,102,927	D221E	probably damaging	Het
Prkg1	T	C	19: 31,585,695	D102G	probably damaging	Het
Psme4	T	A	11: 30,819,011	D662E	probably benign	Het
Ptprn	T	C	1: 75,254,820		probably null	Het
Ptprz1	A	G	6: 22,986,311	D370G	probably damaging	Het
Qser1	A	G	2: 104,760,541	S1637P	probably damaging	Het
Sema6a	T	A	18: 47,270,629	H642L	probably benign	Het
Slc30a5	A	T	13: 100,813,953	F209I	probably benign	Het
Slc4a3	G	T	1: 75,552,191	E508*	probably null	Het
Stpg2	C	T	3: 139,309,183	R370*	probably null	Het
Tas2r113	T	A	6: 132,893,833	F275I	probably benign	Het
Tmem132d	T	G	5: 128,269,199	K86N	probably damaging	Het
Tpgs2	A	T	18: 25,140,536	F189L	probably damaging	Het
Trmt6	A	G	2: 132,811,048	S104P	probably damaging	Het
Trpv3	T	C	11: 73,283,688	S294P	probably damaging	Het
Ugt2b36	A	G	5: 87,080,868		probably null	Het
Vmn1r170	A	T	7: 23,606,481	M103L	probably benign	Het
Vmn2r107	T	A	17: 20,355,617		probably null	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Vmn2r77	T	C	7: 86,800,756	V70A	probably benign	Het

Other mutations in Apc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Apc	APN	18	34316926	missense	probably benign	0.01
IGL00898:Apc	APN	18	34317094	missense	probably damaging	1.00
IGL01111:Apc	APN	18	34315136	missense	possibly damaging	0.95
IGL01347:Apc	APN	18	34317670	missense	probably damaging	1.00
IGL01375:Apc	APN	18	34313654	missense	probably damaging	1.00
IGL01805:Apc	APN	18	34318218	missense	probably benign	0.02
IGL01997:Apc	APN	18	34315423	missense	probably benign	0.00
IGL02033:Apc	APN	18	34310719	missense	probably damaging	1.00
IGL02323:Apc	APN	18	34315810	nonsense	probably null
IGL02373:Apc	APN	18	34316159	missense	probably damaging	1.00
IGL02379:Apc	APN	18	34298745	missense	probably benign	0.45
IGL02456:Apc	APN	18	34313882	nonsense	probably null
IGL02552:Apc	APN	18	34312982	missense	possibly damaging	0.90
IGL02676:Apc	APN	18	34315634	missense	probably damaging	1.00
IGL02756:Apc	APN	18	34314535	missense	probably damaging	1.00
IGL02938:Apc	APN	18	34315228	missense	probably damaging	0.98
IGL02974:Apc	APN	18	34268383	splice site	probably benign
IGL03124:Apc	APN	18	34299985	missense	probably damaging	0.98
IGL03201:Apc	APN	18	34312376	missense	probably damaging	1.00
IGL03339:Apc	APN	18	34298474	missense	probably damaging	1.00
FR4304:Apc	UTSW	18	34281997	intron	probably benign
FR4342:Apc	UTSW	18	34281999	intron	probably benign
FR4449:Apc	UTSW	18	34282000	intron	probably benign
FR4449:Apc	UTSW	18	34282005	intron	probably benign
FR4548:Apc	UTSW	18	34281998	intron	probably benign
FR4737:Apc	UTSW	18	34281999	intron	probably benign
FR4976:Apc	UTSW	18	34281998	intron	probably benign
FR4976:Apc	UTSW	18	34282000	intron	probably benign
FR4976:Apc	UTSW	18	34282004	nonsense	probably null
R0385:Apc	UTSW	18	34315944	missense	probably damaging	1.00
R0535:Apc	UTSW	18	34261072	missense	probably damaging	1.00
R0561:Apc	UTSW	18	34313303	missense	possibly damaging	0.94
R0590:Apc	UTSW	18	34316230	nonsense	probably null
R0626:Apc	UTSW	18	34318454	missense	probably damaging	1.00
R0991:Apc	UTSW	18	34316107	missense	probably damaging	1.00
R1564:Apc	UTSW	18	34315149	missense	probably benign	0.00
R1663:Apc	UTSW	18	34268325	missense	probably damaging	0.98
R1737:Apc	UTSW	18	34317022	missense	probably damaging	1.00
R1739:Apc	UTSW	18	34312318	missense	probably damaging	1.00
R1835:Apc	UTSW	18	34317077	missense	probably damaging	1.00
R1887:Apc	UTSW	18	34272468	missense	probably damaging	1.00
R1957:Apc	UTSW	18	34317335	missense	probably damaging	1.00
R2005:Apc	UTSW	18	34310909	critical splice donor site	probably null
R2013:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2014:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2015:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2017:Apc	UTSW	18	34313602	missense	probably benign	0.00
R2056:Apc	UTSW	18	34316428	missense	probably damaging	1.00
R2108:Apc	UTSW	18	34269229	missense	probably damaging	1.00
R2120:Apc	UTSW	18	34276601	missense	probably damaging	1.00
R2131:Apc	UTSW	18	34312045	missense	possibly damaging	0.51
R2133:Apc	UTSW	18	34312045	missense	possibly damaging	0.51
R2291:Apc	UTSW	18	34312491	missense	probably benign	0.45
R2332:Apc	UTSW	18	34317059	missense	possibly damaging	0.50
R2360:Apc	UTSW	18	34261126	missense	probably damaging	1.00
R2407:Apc	UTSW	18	34314262	missense	possibly damaging	0.77
R2507:Apc	UTSW	18	34316537	missense	possibly damaging	0.77
R2940:Apc	UTSW	18	34276670	missense	probably damaging	1.00
R3404:Apc	UTSW	18	34313602	missense	probably benign	0.00
R3411:Apc	UTSW	18	34269259	splice site	probably benign
R3778:Apc	UTSW	18	34313081	missense	probably damaging	1.00
R3826:Apc	UTSW	18	34279335	missense	possibly damaging	0.93
R4599:Apc	UTSW	18	34317987	nonsense	probably null
R4611:Apc	UTSW	18	34318565	missense	probably damaging	1.00
R4664:Apc	UTSW	18	34298594	missense	probably damaging	0.98
R4969:Apc	UTSW	18	34312918	nonsense	probably null
R5007:Apc	UTSW	18	34312963	missense	probably damaging	1.00
R5066:Apc	UTSW	18	34316105	missense	probably damaging	1.00
R5112:Apc	UTSW	18	34316109	nonsense	probably null
R5259:Apc	UTSW	18	34314290	missense	probably benign	0.29
R5440:Apc	UTSW	18	34221160	unclassified	probably benign
R5508:Apc	UTSW	18	34298580	missense	probably damaging	0.97
R5512:Apc	UTSW	18	34310909	critical splice donor site	probably benign
R5850:Apc	UTSW	18	34318063	missense	possibly damaging	0.94
R5951:Apc	UTSW	18	34317146	missense	possibly damaging	0.89
R5966:Apc	UTSW	18	34221087	utr 5 prime	probably benign
R6081:Apc	UTSW	18	34290111	missense	possibly damaging	0.93
R6116:Apc	UTSW	18	34316455	missense	probably damaging	1.00
R6351:Apc	UTSW	18	34312212	missense	probably damaging	1.00
R6354:Apc	UTSW	18	34312528	missense	probably benign	0.02
R6467:Apc	UTSW	18	34269199	missense	probably benign	0.22
R6974:Apc	UTSW	18	34298427	missense	possibly damaging	0.65
R7027:Apc	UTSW	18	34312076	missense	probably damaging	1.00
R7096:Apc	UTSW	18	34315957	missense	probably damaging	1.00
R7289:Apc	UTSW	18	34315271	missense	probably damaging	1.00
R7439:Apc	UTSW	18	34312073	missense	probably damaging	1.00
R7441:Apc	UTSW	18	34312073	missense	probably damaging	1.00
R7534:Apc	UTSW	18	34316962	missense	probably damaging	1.00
R7685:Apc	UTSW	18	34314208	missense	probably damaging	1.00
R7814:Apc	UTSW	18	34272539	missense	probably damaging	0.98
RF046:Apc	UTSW	18	34282009	critical splice donor site	probably benign
RF063:Apc	UTSW	18	34282009	critical splice donor site	probably benign
X0021:Apc	UTSW	18	34312108	missense	probably damaging	1.00
X0025:Apc	UTSW	18	34312376	missense	probably damaging	1.00
Z1088:Apc	UTSW	18	34313167	nonsense	probably null
Z1177:Apc	UTSW	18	34314463

Predicted Primers

PCR Primer
(F):5'- TATGGAACCAAGGAAAGCCC -3'
(R):5'- TTAGCAGCCTCACATTAGTTCAAC -3'

Sequencing Primer
(F):5'- CTGTGGTATATACTCAGCCGTAAGC -3'
(R):5'- AGTTCAACTTCTCTGTCTAAACTTG -3'

Posted On

2014-08-25