Mutagenetix > Incidental Mutation

Incidental Mutation 'R1974:Prkg1'

221495

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

039987-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.557) question?

Stock #

R1974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31585695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 102 (D102G)

Ref Sequence

ENSEMBL: ENSMUSP00000067576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably damaging
Transcript: ENSMUST00000065067
AA Change: D102G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: D102G

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073581
AA Change: D117G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: D117G

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,267	L739Q	probably damaging	Het
4933436I01Rik	A	T	X: 67,920,049	Y401*	probably null	Het
Abcg3	A	G	5: 104,963,638	V321A	probably benign	Het
Acad10	C	A	5: 121,626,185	V894L	possibly damaging	Het
Adam9	A	G	8: 24,992,224	I255T	probably damaging	Het
AF529169	T	G	9: 89,601,203	T714P	probably damaging	Het
Ago3	T	C	4: 126,346,751	Y785C	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Akap4	A	G	X: 7,077,356	S633G	probably benign	Het
Alox15	T	A	11: 70,349,973	T194S	probably benign	Het
Amh	T	C	10: 80,806,416	S207P	probably benign	Het
Apc	T	A	18: 34,300,004	C415S	possibly damaging	Het
Atg14	G	A	14: 47,545,841	R346C	probably damaging	Het
Atp5j2	A	T	5: 145,184,579	L64Q	probably damaging	Het
Barhl2	C	G	5: 106,457,313	E177Q	probably benign	Het
C1qtnf5	T	C	9: 44,108,775	V232A	probably damaging	Het
Calr	T	C	8: 84,844,157	I290V	probably benign	Het
Cdh19	G	C	1: 110,890,159	Q618E	possibly damaging	Het
Celsr2	G	T	3: 108,414,214	D427E	probably damaging	Het
Cep250	T	C	2: 155,989,504	S1294P	probably damaging	Het
Chrna7	T	A	7: 63,099,286	T483S	probably damaging	Het
Clmn	A	T	12: 104,791,862	W132R	probably damaging	Het
Cpsf2	G	A	12: 101,990,047	D370N	probably benign	Het
Crnn	T	C	3: 93,149,287	V460A	probably benign	Het
Daam1	T	A	12: 71,988,929	I957N	probably damaging	Het
Defb9	T	C	8: 21,881,889	K36R	probably benign	Het
Dock10	T	A	1: 80,510,426	I2007F	possibly damaging	Het
Dpm1	A	T	2: 168,217,747	V143D	probably damaging	Het
Dync1h1	T	C	12: 110,625,732	V1110A	possibly damaging	Het
Erlec1	T	G	11: 30,939,604	K373N	possibly damaging	Het
Fam160b1	T	C	19: 57,385,377	F690L	probably damaging	Het
Fbxo40	C	T	16: 36,969,941	G269E	probably benign	Het
Fbxw7	T	A	3: 84,954,935	C70S	possibly damaging	Het
Fnbp1	G	T	2: 31,053,047	R280S	probably null	Het
Gapvd1	G	A	2: 34,700,841	R940C	probably damaging	Het
Gfod2	T	C	8: 105,717,510	K134E	possibly damaging	Het
Gm13757	A	T	2: 88,446,509	I143N	probably damaging	Het
Gpi1	A	T	7: 34,220,803		probably null	Het
Grik2	A	T	10: 49,132,827	N721K	possibly damaging	Het
Gsn	G	T	2: 35,301,471	G455V	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Hpse	A	G	5: 100,692,238	S338P	probably damaging	Het
Hyal2	T	C	9: 107,572,172	C376R	probably damaging	Het
Inf2	A	G	12: 112,608,337	T781A	unknown	Het
Iscu	A	G	5: 113,777,018		probably benign	Het
Kcna4	G	A	2: 107,296,220	G433D	possibly damaging	Het
Kir3dl2	T	A	X: 136,456,275	N146I	probably benign	Het
Klrg1	T	A	6: 122,282,762	Q17L	possibly damaging	Het
Krt82	T	G	15: 101,545,162	Q263P	probably benign	Het
Mfrp	T	C	9: 44,106,372	C554R	probably damaging	Het
Mst1r	T	C	9: 107,914,763	Y833H	probably damaging	Het
Mst1r	T	A	9: 107,915,933		probably null	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nipal4	T	C	11: 46,151,383	N157S	probably damaging	Het
Notch2	G	A	3: 98,072,755	G195D	probably damaging	Het
Nrcam	A	T	12: 44,563,993	H492L	probably benign	Het
Olfr433	A	T	1: 174,042,588	I213F	probably damaging	Het
Papln	G	A	12: 83,782,037	R817H	probably damaging	Het
Pcnx2	T	C	8: 125,887,371	E447G	probably benign	Het
Pdp2	T	C	8: 104,593,906	V129A	probably benign	Het
Plch2	A	G	4: 154,984,953	F1072S	possibly damaging	Het
Prag1	T	A	8: 36,102,927	D221E	probably damaging	Het
Psme4	T	A	11: 30,819,011	D662E	probably benign	Het
Ptprn	T	C	1: 75,254,820		probably null	Het
Ptprz1	A	G	6: 22,986,311	D370G	probably damaging	Het
Qser1	A	G	2: 104,760,541	S1637P	probably damaging	Het
Sema6a	T	A	18: 47,270,629	H642L	probably benign	Het
Slc30a5	A	T	13: 100,813,953	F209I	probably benign	Het
Slc4a3	G	T	1: 75,552,191	E508*	probably null	Het
Stpg2	C	T	3: 139,309,183	R370*	probably null	Het
Tas2r113	T	A	6: 132,893,833	F275I	probably benign	Het
Tmem132d	T	G	5: 128,269,199	K86N	probably damaging	Het
Tpgs2	A	T	18: 25,140,536	F189L	probably damaging	Het
Trmt6	A	G	2: 132,811,048	S104P	probably damaging	Het
Trpv3	T	C	11: 73,283,688	S294P	probably damaging	Het
Ugt2b36	A	G	5: 87,080,868		probably null	Het
Vmn1r170	A	T	7: 23,606,481	M103L	probably benign	Het
Vmn2r107	T	A	17: 20,355,617		probably null	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Vmn2r77	T	C	7: 86,800,756	V70A	probably benign	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGCGATCCTTGAGAACCTCAG -3'
(R):5'- GTCACTTGCCAAATGATAGTTTGC -3'

Sequencing Primer
(F):5'- CGATCCTTGAGAACCTCAGAAGTTAG -3'
(R):5'- GCCAAATGATAGTTTGCTTAATGG -3'

Posted On

2014-08-25