Incidental Mutation 'R0139:Ndor1'
ID22150
Institutional Source Beutler Lab
Gene Symbol Ndor1
Ensembl Gene ENSMUSG00000006471
Gene NameNADPH dependent diflavin oxidoreductase 1
SynonymsNR1, 4930447P04Rik
MMRRC Submission 038424-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R0139 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location25244821-25256022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25248354 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 405 (V405M)
Ref Sequence ENSEMBL: ENSMUSP00000154261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060818] [ENSMUST00000100329] [ENSMUST00000114349] [ENSMUST00000114355] [ENSMUST00000132128] [ENSMUST00000147866] [ENSMUST00000148589] [ENSMUST00000154498] [ENSMUST00000228052] [ENSMUST00000228627]
Predicted Effect probably benign
Transcript: ENSMUST00000060818
SMART Domains Protein: ENSMUSP00000057742
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100329
AA Change: V407M

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097903
Gene: ENSMUSG00000006471
AA Change: V407M

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 124 2.3e-23 PFAM
Pfam:FAD_binding_1 134 354 8e-50 PFAM
Pfam:NAD_binding_1 389 495 2.1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114349
AA Change: V474M

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109989
Gene: ENSMUSG00000006471
AA Change: V474M

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 145 2.3e-32 PFAM
Pfam:FAD_binding_1 201 421 2e-48 PFAM
Pfam:NAD_binding_1 456 561 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114355
SMART Domains Protein: ENSMUSP00000109995
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129705
Predicted Effect probably benign
Transcript: ENSMUST00000132128
SMART Domains Protein: ENSMUSP00000125018
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 48 2e-9 PDB
SCOP:d1f4pa_ 4 57 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137355
Predicted Effect probably benign
Transcript: ENSMUST00000141808
SMART Domains Protein: ENSMUSP00000123247
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 7 120 8.1e-25 PFAM
Pfam:FAD_binding_1 167 225 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147866
SMART Domains Protein: ENSMUSP00000125259
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Pfam:Flavodoxin_1 93 196 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148589
SMART Domains Protein: ENSMUSP00000123958
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 49 7e-10 PDB
SCOP:d1f4pa_ 4 45 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154498
Predicted Effect possibly damaging
Transcript: ENSMUST00000228052
AA Change: V405M

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000228627
Meta Mutation Damage Score 0.3432 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,620,214 probably benign Het
2010111I01Rik A G 13: 63,190,484 N558S probably benign Het
A230072I06Rik C T 8: 12,279,899 S118L unknown Het
Adprhl2 A G 4: 126,318,154 Y122H probably damaging Het
Ankrd52 T C 10: 128,386,138 S544P probably benign Het
Arhgef7 A G 8: 11,800,503 E111G probably damaging Het
Atp11a A G 8: 12,846,054 M755V probably benign Het
Atp2a2 A G 5: 122,491,715 I97T probably damaging Het
Bmp3 G A 5: 98,879,909 D463N possibly damaging Het
Cacna2d4 T C 6: 119,278,269 probably benign Het
Ccdc28a G A 10: 18,230,440 S46F possibly damaging Het
Ccdc36 T C 9: 108,412,496 T176A probably damaging Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Cenpw T G 10: 30,200,459 T8P probably benign Het
Cfap44 G C 16: 44,433,422 G893R possibly damaging Het
Cops7a A T 6: 124,961,360 C110S probably damaging Het
Cstl1 A G 2: 148,755,325 N134S probably damaging Het
Cyp2s1 G T 7: 25,811,689 probably null Het
Dio2 T A 12: 90,729,843 N124Y probably damaging Het
Ecel1 C A 1: 87,154,526 G155V possibly damaging Het
Efr3a G T 15: 65,845,981 V337F possibly damaging Het
Eva1b A C 4: 126,149,653 H162P probably damaging Het
Exoc5 C T 14: 49,036,036 E301K probably damaging Het
F13b G A 1: 139,508,203 S249N probably damaging Het
Fam120b C T 17: 15,426,184 probably benign Het
Gbf1 T C 19: 46,261,792 L396S probably damaging Het
Gck T A 11: 5,909,139 K143* probably null Het
Gck C A 11: 5,910,370 V91L probably damaging Het
Glt8d2 T C 10: 82,660,810 N138S probably damaging Het
Gm17359 A T 3: 79,405,835 Y72F probably damaging Het
Gm4884 T C 7: 41,042,963 F119L probably benign Het
Igsf11 T C 16: 39,008,878 S45P probably damaging Het
Il10 G A 1: 131,022,534 V142M probably damaging Het
Insc A T 7: 114,769,002 H9L probably damaging Het
Iqsec1 G T 6: 90,809,758 probably benign Het
Katnb1 A G 8: 95,098,422 S611G possibly damaging Het
Kcnb1 A G 2: 167,105,539 I463T possibly damaging Het
Lao1 A G 4: 118,964,202 N90S probably benign Het
Med16 T A 10: 79,896,801 M710L probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mtus1 G A 8: 41,016,196 probably benign Het
Mybpc3 A G 2: 91,120,337 probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nme8 T C 13: 19,677,848 I204V probably benign Het
Nup133 A T 8: 123,929,343 N466K probably benign Het
Nxt1 A G 2: 148,675,470 T44A probably benign Het
Olfr1303 A T 2: 111,814,354 I124K possibly damaging Het
Olfr1382 C T 11: 49,535,574 L130F probably benign Het
Olfr1508 T C 14: 52,463,212 T239A probably damaging Het
Olfr310 T C 7: 86,268,979 E270G probably benign Het
Olfr697 A T 7: 106,741,625 I103N probably benign Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Pced1a T C 2: 130,421,907 K275R probably benign Het
Pdcd11 A G 19: 47,110,959 probably null Het
Phldb2 A C 16: 45,770,666 probably benign Het
Pifo A T 3: 105,999,570 M171K possibly damaging Het
Piwil1 C A 5: 128,747,323 S490Y probably damaging Het
Plekhh3 T C 11: 101,163,675 probably benign Het
Ppargc1b A T 18: 61,315,963 probably benign Het
Psg19 C T 7: 18,797,017 V71I possibly damaging Het
Ptk6 T C 2: 181,196,931 probably benign Het
Pus7 A G 5: 23,778,092 S126P probably damaging Het
Rab6b T A 9: 103,140,377 probably null Het
Ranbp3 G A 17: 56,709,272 R347Q possibly damaging Het
Sbf1 A T 15: 89,302,498 L866Q probably damaging Het
Slc25a34 A G 4: 141,622,352 V164A possibly damaging Het
Smg1 A G 7: 118,152,675 probably null Het
Spin1 G T 13: 51,149,012 V214L probably benign Het
Sptbn1 T C 11: 30,142,289 N492S probably benign Het
Stk-ps2 A G 1: 46,029,795 noncoding transcript Het
Taar7f T C 10: 24,050,414 I302T probably benign Het
Tdrd1 C A 19: 56,843,198 H340Q probably benign Het
Thumpd3 A G 6: 113,067,801 D498G probably benign Het
Tpgs2 A G 18: 25,149,185 L103P probably damaging Het
Trip10 A G 17: 57,261,633 probably null Het
Trip6 A T 5: 137,312,174 H269Q probably benign Het
Trmt12 T C 15: 58,872,894 V47A possibly damaging Het
Trpm7 A T 2: 126,812,771 S1416T probably benign Het
Tsks G A 7: 44,954,459 A438T probably benign Het
Ttn T C 2: 76,897,286 probably benign Het
Twf2 G A 9: 106,212,956 V136M possibly damaging Het
Uty A C Y: 1,197,223 Y115D probably damaging Het
Vcan A G 13: 89,691,261 S2055P probably damaging Het
Yes1 A G 5: 32,684,695 Q521R possibly damaging Het
Zfp114 A T 7: 24,181,260 T344S possibly damaging Het
Zfp661 A T 2: 127,578,612 V89D possibly damaging Het
Zfp91 A T 19: 12,770,470 Y430N probably damaging Het
Other mutations in Ndor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Ndor1 APN 2 25250139 missense probably benign 0.05
IGL02174:Ndor1 APN 2 25249194 missense possibly damaging 0.49
IGL02366:Ndor1 APN 2 25247981 missense possibly damaging 0.94
IGL02407:Ndor1 APN 2 25249269 missense probably benign 0.39
IGL02630:Ndor1 APN 2 25255287 missense probably damaging 1.00
R0194:Ndor1 UTSW 2 25248706 unclassified probably null
R0926:Ndor1 UTSW 2 25248348 missense probably benign 0.08
R1530:Ndor1 UTSW 2 25248909 missense probably benign 0.02
R1533:Ndor1 UTSW 2 25249267 missense probably damaging 0.98
R1837:Ndor1 UTSW 2 25248396 missense probably damaging 1.00
R1954:Ndor1 UTSW 2 25255293 missense possibly damaging 0.86
R1981:Ndor1 UTSW 2 25255224 missense probably damaging 0.97
R2090:Ndor1 UTSW 2 25249218 missense probably damaging 1.00
R2188:Ndor1 UTSW 2 25251753 unclassified probably null
R3433:Ndor1 UTSW 2 25247811 missense possibly damaging 0.91
R3620:Ndor1 UTSW 2 25248035 missense probably damaging 1.00
R4013:Ndor1 UTSW 2 25250150 missense probably damaging 0.98
R4411:Ndor1 UTSW 2 25248480 missense probably benign 0.08
R4457:Ndor1 UTSW 2 25248116 unclassified probably null
R4942:Ndor1 UTSW 2 25248121 critical splice donor site probably null
R5132:Ndor1 UTSW 2 25247769 missense probably benign 0.28
R6476:Ndor1 UTSW 2 25248142 missense possibly damaging 0.95
R6702:Ndor1 UTSW 2 25249890 missense possibly damaging 0.95
R6703:Ndor1 UTSW 2 25249890 missense possibly damaging 0.95
R8016:Ndor1 UTSW 2 25249317 missense probably benign 0.00
X0018:Ndor1 UTSW 2 25247844 missense probably benign 0.03
X0019:Ndor1 UTSW 2 25248181 missense probably damaging 1.00
Z1177:Ndor1 UTSW 2 25247789 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTTCAGCCATCCCAACTCCTG -3'
(R):5'- AGCACCTTAGCACTGTCTTTTGACC -3'

Sequencing Primer
(F):5'- TGTAACCAGGGTCAGCCAG -3'
(R):5'- AGCACTGTCTTTTGACCTCCTAC -3'
Posted On2013-04-16