Mutagenetix > Incidental Mutations

Incidental Mutation 'R2033:Trpc1'

221506

Institutional Source

Beutler Lab

Gene Symbol

Trpc1

Ensembl Gene

ENSMUSG00000032839

Gene Name

transient receptor potential cation channel, subfamily C, member 1

Synonyms

Trrp1, Mtrp1, Trp1

MMRRC Submission

040040-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.221) question?

Stock #

R2033 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95705082-95750375 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95706843 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 742 (N742S)

Ref Sequence

ENSEMBL: ENSMUSP00000057640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053785] [ENSMUST00000189137] [ENSMUST00000190497] [ENSMUST00000190604]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053785
AA Change: N742S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839
AA Change: N742S

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	2.6e-27	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
Pfam:Ion_trans	407	673	5.9e-17	PFAM
coiled coil region	770	794	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189137
AA Change: N776S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839
AA Change: N776S

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	1.8e-29	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
transmembrane domain	407	424	N/A	INTRINSIC
Pfam:Ion_trans	441	661	1.2e-21	PFAM
coiled coil region	770	794	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190497

SMART Domains

Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190604

SMART Domains

Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

Meta Mutation Damage Score

0.1055

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	T	C	4: 144,456,383	T172A	probably benign	Het
Atp6v1c1	T	C	15: 38,673,966		probably null	Het
Bpifc	G	A	10: 86,000,632	T3I	possibly damaging	Het
Car12	A	G	9: 66,717,558		probably null	Het
Ccrl2	A	G	9: 111,055,870	F187L	possibly damaging	Het
Cep250	G	A	2: 155,970,892	R544H	probably damaging	Het
Col4a3	T	G	1: 82,718,011		probably benign	Het
Cyb5r2	T	C	7: 107,756,907		probably null	Het
Elfn2	A	G	15: 78,671,896	V817A	probably damaging	Het
Eln	C	T	5: 134,710,106		probably null	Het
Eml5	T	C	12: 98,791,386	E1896G	possibly damaging	Het
G530012D18Rik	CACAGA	CA	1: 85,577,154		probably null	Het
Galnt11	C	T	5: 25,247,538	T16I	probably damaging	Het
Gars	C	T	6: 55,077,723	H672Y	probably benign	Het
Gpr155	T	A	2: 73,348,182	H726L	probably benign	Het
Inpp1	T	A	1: 52,790,173	N229I	possibly damaging	Het
Isg20	A	C	7: 78,916,533	I77L	probably damaging	Het
Kit	G	C	5: 75,637,317	D422H	possibly damaging	Het
Lonp2	A	G	8: 86,708,942	E602G	possibly damaging	Het
Mink1	T	C	11: 70,612,508	V1143A	probably damaging	Het
Myh6	A	C	14: 54,963,645	L120R	probably benign	Het
Myo18a	T	A	11: 77,843,099		probably null	Het
Nphs2	T	C	1: 156,323,738	V249A	probably damaging	Het
Npsr1	A	G	9: 24,313,352	K342E	probably benign	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Nudt18	G	T	14: 70,579,616	G162V	possibly damaging	Het
Odam	A	G	5: 87,892,419	D248G	probably benign	Het
Olfr1224-ps1	A	G	2: 89,157,154	V7A	probably damaging	Het
Olfr147	G	T	9: 38,403,373	M166I	probably damaging	Het
Olfr390	T	C	11: 73,787,438	S167P	probably benign	Het
Olfr557	A	G	7: 102,699,162	E308G	probably benign	Het
Olfr572	T	C	7: 102,928,408	V260A	probably benign	Het
Pde4b	G	T	4: 102,605,295	D723Y	probably benign	Het
Pdzrn3	T	C	6: 101,150,954	E917G	probably damaging	Het
Ppip5k1	C	T	2: 121,337,627	R715H	probably damaging	Het
Prkdc	T	A	16: 15,687,352		probably benign	Het
Ptp4a3	A	G	15: 73,753,769	Y21C	probably damaging	Het
Ptprk	C	A	10: 28,592,767		probably benign	Het
Rfesd	C	A	13: 76,002,872		probably null	Het
Rtel1	A	T	2: 181,351,863	K592*	probably null	Het
Siah1a	T	A	8: 86,725,270	K195N	probably damaging	Het
Slc5a5	G	T	8: 70,888,587	D369E	probably damaging	Het
Slc6a6	A	T	6: 91,724,910	I100F	probably benign	Het
Smtn	T	C	11: 3,517,781	I913V	probably benign	Het
Stk17b	A	G	1: 53,761,076	S248P	probably damaging	Het
Sun1	C	T	5: 139,225,438	H149Y	probably damaging	Het
Taar5	T	C	10: 23,971,094	I130T	possibly damaging	Het
Tmem132b	G	T	5: 125,749,289	V448F	probably damaging	Het
Tmem94	C	A	11: 115,794,328	N888K	possibly damaging	Het
Ttbk2	T	C	2: 120,806,849	T112A	probably damaging	Het
Tubb2a	A	T	13: 34,075,456	L117Q	probably damaging	Het
Vmn1r60	T	A	7: 5,544,820	M94L	probably benign	Het
Vmn2r83	A	G	10: 79,491,819	T754A	probably benign	Het

Other mutations in Trpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Trpc1	APN	9	95726494	missense	probably damaging	1.00
IGL02094:Trpc1	APN	9	95743281	missense	probably damaging	1.00
IGL02412:Trpc1	APN	9	95736861	missense	probably damaging	1.00
IGL02494:Trpc1	APN	9	95708307	missense	probably damaging	1.00
IGL02943:Trpc1	APN	9	95708853	splice site	probably benign
IGL03025:Trpc1	APN	9	95710260	missense	probably damaging	1.00
IGL03221:Trpc1	APN	9	95706900	missense	probably damaging	1.00
Enlarged	UTSW	9	95721471	critical splice acceptor site	probably null
luxus	UTSW	9	95721132	critical splice donor site	probably null
Magnified	UTSW	9	95726437	missense	probably damaging	1.00
PIT4581001:Trpc1	UTSW	9	95736921	missense	probably benign	0.21
R0034:Trpc1	UTSW	9	95749761	missense	probably damaging	0.98
R1973:Trpc1	UTSW	9	95723255	missense	probably benign
R2117:Trpc1	UTSW	9	95717584	missense	probably damaging	1.00
R2262:Trpc1	UTSW	9	95706933	missense	probably damaging	1.00
R2910:Trpc1	UTSW	9	95749842	missense	probably benign	0.00
R2918:Trpc1	UTSW	9	95723129	missense	probably damaging	1.00
R3156:Trpc1	UTSW	9	95721132	critical splice donor site	probably null
R3427:Trpc1	UTSW	9	95732196	missense	probably benign	0.12
R4093:Trpc1	UTSW	9	95706865	missense	probably benign	0.12
R4384:Trpc1	UTSW	9	95732108	missense	probably benign	0.13
R4787:Trpc1	UTSW	9	95721415	missense	probably benign	0.02
R5327:Trpc1	UTSW	9	95721471	critical splice acceptor site	probably null
R5576:Trpc1	UTSW	9	95721324	missense	probably damaging	0.97
R6320:Trpc1	UTSW	9	95721250	missense	probably damaging	1.00
R6499:Trpc1	UTSW	9	95726437	missense	probably damaging	1.00
R6714:Trpc1	UTSW	9	95723273	missense	probably damaging	1.00
R7179:Trpc1	UTSW	9	95721144	missense	possibly damaging	0.82
R7265:Trpc1	UTSW	9	95708275	missense	probably benign
X0026:Trpc1	UTSW	9	95732044	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- ATGGAGTTAAGCACTGACCAAC -3'
(R):5'- CATACACATATGTTGTTCTGCTGTC -3'

Sequencing Primer
(F):5'- CGGGTTTGCTTCTACAAAAAGCC -3'
(R):5'- TCTGCTGTCATTAATTACCATATGG -3'

Posted On

2014-08-25