Incidental Mutation 'R2033:Trpc1'
ID221506
Institutional Source Beutler Lab
Gene Symbol Trpc1
Ensembl Gene ENSMUSG00000032839
Gene Nametransient receptor potential cation channel, subfamily C, member 1
SynonymsTrrp1, Mtrp1, Trp1
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95705082-95750375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95706843 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 742 (N742S)
Ref Sequence ENSEMBL: ENSMUSP00000057640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053785] [ENSMUST00000189137] [ENSMUST00000190497] [ENSMUST00000190604]
Predicted Effect probably damaging
Transcript: ENSMUST00000053785
AA Change: N742S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839
AA Change: N742S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189137
AA Change: N776S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839
AA Change: N776S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190497
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190604
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Trpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Trpc1 APN 9 95726494 missense probably damaging 1.00
IGL02094:Trpc1 APN 9 95743281 missense probably damaging 1.00
IGL02412:Trpc1 APN 9 95736861 missense probably damaging 1.00
IGL02494:Trpc1 APN 9 95708307 missense probably damaging 1.00
IGL02943:Trpc1 APN 9 95708853 splice site probably benign
IGL03025:Trpc1 APN 9 95710260 missense probably damaging 1.00
IGL03221:Trpc1 APN 9 95706900 missense probably damaging 1.00
Enlarged UTSW 9 95721471 critical splice acceptor site probably null
luxus UTSW 9 95721132 critical splice donor site probably null
Magnified UTSW 9 95726437 missense probably damaging 1.00
PIT4581001:Trpc1 UTSW 9 95736921 missense probably benign 0.21
R0034:Trpc1 UTSW 9 95749761 missense probably damaging 0.98
R1973:Trpc1 UTSW 9 95723255 missense probably benign
R2117:Trpc1 UTSW 9 95717584 missense probably damaging 1.00
R2262:Trpc1 UTSW 9 95706933 missense probably damaging 1.00
R2910:Trpc1 UTSW 9 95749842 missense probably benign 0.00
R2918:Trpc1 UTSW 9 95723129 missense probably damaging 1.00
R3156:Trpc1 UTSW 9 95721132 critical splice donor site probably null
R3427:Trpc1 UTSW 9 95732196 missense probably benign 0.12
R4093:Trpc1 UTSW 9 95706865 missense probably benign 0.12
R4384:Trpc1 UTSW 9 95732108 missense probably benign 0.13
R4787:Trpc1 UTSW 9 95721415 missense probably benign 0.02
R5327:Trpc1 UTSW 9 95721471 critical splice acceptor site probably null
R5576:Trpc1 UTSW 9 95721324 missense probably damaging 0.97
R6320:Trpc1 UTSW 9 95721250 missense probably damaging 1.00
R6499:Trpc1 UTSW 9 95726437 missense probably damaging 1.00
R6714:Trpc1 UTSW 9 95723273 missense probably damaging 1.00
R7179:Trpc1 UTSW 9 95721144 missense possibly damaging 0.82
R7265:Trpc1 UTSW 9 95708275 missense probably benign
X0026:Trpc1 UTSW 9 95732044 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATGGAGTTAAGCACTGACCAAC -3'
(R):5'- CATACACATATGTTGTTCTGCTGTC -3'

Sequencing Primer
(F):5'- CGGGTTTGCTTCTACAAAAAGCC -3'
(R):5'- TCTGCTGTCATTAATTACCATATGG -3'
Posted On2014-08-25