Incidental Mutation 'R2033:Bpifc'
ID221517
Institutional Source Beutler Lab
Gene Symbol Bpifc
Ensembl Gene ENSMUSG00000050108
Gene NameBPI fold containing family C
SynonymsBpil2
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2033 (G1)
Quality Score157
Status Validated
Chromosome10
Chromosomal Location85959340-86011895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86000632 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 3 (T3I)
Ref Sequence ENSEMBL: ENSMUSP00000100941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061699] [ENSMUST00000105304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061699
AA Change: T3I

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063107
Gene: ENSMUSG00000050108
AA Change: T3I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
BPI1 33 257 8.89e-23 SMART
BPI2 272 474 2.29e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105304
AA Change: T3I

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100941
Gene: ENSMUSG00000050108
AA Change: T3I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1ewfa1 26 82 2e-13 SMART
Blast:BPI1 33 82 7e-27 BLAST
Meta Mutation Damage Score 0.2035 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Bpifc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Bpifc APN 10 85960528 missense possibly damaging 0.85
IGL01474:Bpifc APN 10 86000639 start codon destroyed probably damaging 0.98
IGL02437:Bpifc APN 10 85988731 missense probably damaging 1.00
R0689:Bpifc UTSW 10 85960547 splice site probably benign
R1205:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R1524:Bpifc UTSW 10 85977735 missense probably benign 0.01
R3103:Bpifc UTSW 10 85993422 missense probably damaging 1.00
R3609:Bpifc UTSW 10 86000638 start codon destroyed probably null 1.00
R3874:Bpifc UTSW 10 85991254 missense probably benign
R4728:Bpifc UTSW 10 85991199 missense possibly damaging 0.50
R5079:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R5193:Bpifc UTSW 10 86000633 missense probably benign 0.01
R6280:Bpifc UTSW 10 85977712 missense probably benign 0.02
R6291:Bpifc UTSW 10 85976258 missense probably damaging 1.00
R6945:Bpifc UTSW 10 85979214 missense probably benign 0.00
R7288:Bpifc UTSW 10 85988721 missense possibly damaging 0.95
R7310:Bpifc UTSW 10 85963027 missense probably damaging 1.00
R7463:Bpifc UTSW 10 85979334 missense probably benign 0.00
R7807:Bpifc UTSW 10 85976250 missense possibly damaging 0.80
R8004:Bpifc UTSW 10 85979284 missense probably benign
Z1176:Bpifc UTSW 10 85965228 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCATGCAGGTAGACCTCAG -3'
(R):5'- TACACATGACTCCTGAATGGATGC -3'

Sequencing Primer
(F):5'- CATGCAGGTAGACCTCAGATCTG -3'
(R):5'- CATGACTCCTGAATGGATGCATAAG -3'
Posted On2014-08-25