Incidental Mutation 'R2033:Smtn'
ID 221519
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Name smoothelin
Synonyms
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.515) question?
Stock # R2033 (G1)
Quality Score 221
Status Validated
Chromosome 11
Chromosomal Location 3467522-3489337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3467781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 913 (I913V)
Ref Sequence ENSEMBL: ENSMUSP00000105638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000094469] [ENSMUST00000110011] [ENSMUST00000170588]
AlphaFold Q921U8
Predicted Effect probably benign
Transcript: ENSMUST00000020718
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020721
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075118
AA Change: I890V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439
AA Change: I890V

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094469
SMART Domains Protein: ENSMUSP00000092041
Gene: ENSMUSG00000075702

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sep15_SelM 40 114 3.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110011
AA Change: I913V

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439
AA Change: I913V

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably benign
Transcript: ENSMUST00000170588
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Meta Mutation Damage Score 0.0806 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3,476,326 (GRCm39) critical splice donor site probably null
IGL02335:Smtn APN 11 3,476,215 (GRCm39) missense probably damaging 1.00
IGL02473:Smtn APN 11 3,482,463 (GRCm39) missense probably damaging 1.00
IGL02678:Smtn APN 11 3,476,353 (GRCm39) missense possibly damaging 0.95
IGL02824:Smtn APN 11 3,482,658 (GRCm39) missense probably damaging 1.00
IGL03067:Smtn APN 11 3,480,165 (GRCm39) missense possibly damaging 0.53
IGL03142:Smtn APN 11 3,482,601 (GRCm39) nonsense probably null
runtish UTSW 11 3,481,326 (GRCm39) missense possibly damaging 0.89
R0279:Smtn UTSW 11 3,480,235 (GRCm39) missense probably damaging 0.99
R0523:Smtn UTSW 11 3,474,664 (GRCm39) missense possibly damaging 0.89
R0855:Smtn UTSW 11 3,471,880 (GRCm39) missense probably damaging 1.00
R1080:Smtn UTSW 11 3,467,693 (GRCm39) missense probably damaging 1.00
R1218:Smtn UTSW 11 3,480,021 (GRCm39) missense probably benign
R1571:Smtn UTSW 11 3,480,102 (GRCm39) missense probably benign 0.00
R1899:Smtn UTSW 11 3,481,326 (GRCm39) missense possibly damaging 0.89
R2126:Smtn UTSW 11 3,480,045 (GRCm39) missense probably benign 0.02
R2358:Smtn UTSW 11 3,482,865 (GRCm39) splice site probably null
R3690:Smtn UTSW 11 3,477,687 (GRCm39) intron probably benign
R3712:Smtn UTSW 11 3,482,865 (GRCm39) splice site probably null
R4108:Smtn UTSW 11 3,476,449 (GRCm39) missense probably benign 0.10
R4709:Smtn UTSW 11 3,474,663 (GRCm39) missense probably damaging 0.99
R4710:Smtn UTSW 11 3,474,663 (GRCm39) missense probably damaging 0.99
R4830:Smtn UTSW 11 3,470,736 (GRCm39) intron probably benign
R4944:Smtn UTSW 11 3,472,916 (GRCm39) missense probably damaging 1.00
R4959:Smtn UTSW 11 3,477,825 (GRCm39) start codon destroyed probably null
R5223:Smtn UTSW 11 3,479,530 (GRCm39) missense probably benign 0.00
R5554:Smtn UTSW 11 3,470,811 (GRCm39) nonsense probably null
R5610:Smtn UTSW 11 3,479,582 (GRCm39) missense probably damaging 1.00
R5636:Smtn UTSW 11 3,467,829 (GRCm39) critical splice acceptor site probably null
R5972:Smtn UTSW 11 3,483,486 (GRCm39) missense probably damaging 1.00
R6108:Smtn UTSW 11 3,479,608 (GRCm39) missense probably damaging 0.99
R6227:Smtn UTSW 11 3,477,624 (GRCm39) intron probably benign
R7016:Smtn UTSW 11 3,480,368 (GRCm39) critical splice donor site probably null
R7423:Smtn UTSW 11 3,481,200 (GRCm39) critical splice donor site probably null
R7426:Smtn UTSW 11 3,480,249 (GRCm39) missense probably benign 0.10
R7447:Smtn UTSW 11 3,480,196 (GRCm39) missense probably benign
R7496:Smtn UTSW 11 3,479,988 (GRCm39) missense probably damaging 0.99
R7716:Smtn UTSW 11 3,474,708 (GRCm39) missense probably benign 0.00
R8762:Smtn UTSW 11 3,476,407 (GRCm39) missense probably benign 0.00
R8925:Smtn UTSW 11 3,479,477 (GRCm39) missense possibly damaging 0.68
R8927:Smtn UTSW 11 3,479,477 (GRCm39) missense possibly damaging 0.68
R8932:Smtn UTSW 11 3,472,908 (GRCm39) missense probably benign 0.01
R9137:Smtn UTSW 11 3,472,838 (GRCm39) missense possibly damaging 0.93
R9502:Smtn UTSW 11 3,482,780 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACGCTGCGTGTGTACAAAG -3'
(R):5'- TCCGATCGATGGACAGACAG -3'

Sequencing Primer
(F):5'- TTTTGACAGACGGGGCAGC -3'
(R):5'- TGACAACTCCTGTTGCC -3'
Posted On 2014-08-25