Incidental Mutation 'R2033:Mink1'
ID 221522
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Name misshapen-like kinase 1 (zebrafish)
Synonyms Misshapen/NIKs-related kinase, Map4k6, Ysk2, MINK
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70453707-70505309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70503334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1143 (V1143A)
Ref Sequence ENSEMBL: ENSMUSP00000072091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559] [ENSMUST00000144960] [ENSMUST00000135865] [ENSMUST00000180052]
AlphaFold Q9JM52
Predicted Effect probably benign
Transcript: ENSMUST00000014753
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072237
AA Change: V1143A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: V1143A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072873
AA Change: V1136A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: V1136A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079244
AA Change: V1133A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: V1133A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102556
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102558
AA Change: V1099A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: V1099A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect unknown
Transcript: ENSMUST00000136663
AA Change: V996A
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: V996A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102559
AA Change: V1107A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: V1107A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132208
Predicted Effect probably benign
Transcript: ENSMUST00000144960
SMART Domains Protein: ENSMUSP00000136077
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135865
SMART Domains Protein: ENSMUSP00000135933
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 101 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180052
SMART Domains Protein: ENSMUSP00000137259
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Meta Mutation Damage Score 0.6917 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70,494,638 (GRCm39) missense probably damaging 0.99
IGL00709:Mink1 APN 11 70,503,845 (GRCm39) missense probably damaging 0.99
IGL01064:Mink1 APN 11 70,494,307 (GRCm39) missense probably benign 0.05
IGL02612:Mink1 APN 11 70,488,052 (GRCm39) missense probably damaging 1.00
IGL02797:Mink1 APN 11 70,501,176 (GRCm39) missense probably damaging 1.00
IGL03056:Mink1 APN 11 70,503,409 (GRCm39) critical splice donor site probably null
IGL03066:Mink1 APN 11 70,499,715 (GRCm39) missense probably benign 0.01
IGL03185:Mink1 APN 11 70,494,686 (GRCm39) missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70,489,714 (GRCm39) missense probably benign 0.05
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0488:Mink1 UTSW 11 70,488,030 (GRCm39) missense probably damaging 1.00
R0637:Mink1 UTSW 11 70,492,502 (GRCm39) missense probably damaging 0.96
R0828:Mink1 UTSW 11 70,500,971 (GRCm39) nonsense probably null
R1081:Mink1 UTSW 11 70,497,861 (GRCm39) missense probably benign 0.07
R1175:Mink1 UTSW 11 70,502,166 (GRCm39) missense probably benign 0.02
R1441:Mink1 UTSW 11 70,497,940 (GRCm39) missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70,492,833 (GRCm39) missense probably null 1.00
R1545:Mink1 UTSW 11 70,489,717 (GRCm39) missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70,499,706 (GRCm39) missense probably benign 0.00
R1932:Mink1 UTSW 11 70,499,254 (GRCm39) critical splice donor site probably null
R2184:Mink1 UTSW 11 70,494,623 (GRCm39) missense probably damaging 1.00
R2267:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R2268:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R2859:Mink1 UTSW 11 70,503,334 (GRCm39) missense probably damaging 1.00
R3713:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R3717:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R4607:Mink1 UTSW 11 70,496,893 (GRCm39) missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70,500,086 (GRCm39) splice site probably null
R4790:Mink1 UTSW 11 70,489,867 (GRCm39) missense probably damaging 0.99
R4847:Mink1 UTSW 11 70,492,854 (GRCm39) missense probably damaging 1.00
R4860:Mink1 UTSW 11 70,502,418 (GRCm39) missense probably damaging 0.98
R4860:Mink1 UTSW 11 70,502,418 (GRCm39) missense probably damaging 0.98
R5081:Mink1 UTSW 11 70,495,970 (GRCm39) missense probably damaging 0.98
R5310:Mink1 UTSW 11 70,498,169 (GRCm39) missense probably benign 0.33
R5677:Mink1 UTSW 11 70,495,991 (GRCm39) missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70,496,901 (GRCm39) missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70,498,616 (GRCm39) missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70,500,885 (GRCm39) unclassified probably benign
R5950:Mink1 UTSW 11 70,500,412 (GRCm39) missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70,489,915 (GRCm39) missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6058:Mink1 UTSW 11 70,502,546 (GRCm39) missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70,501,478 (GRCm39) missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70,500,927 (GRCm39) missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70,489,720 (GRCm39) missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70,494,151 (GRCm39) splice site probably null
R6269:Mink1 UTSW 11 70,489,813 (GRCm39) missense probably damaging 1.00
R6273:Mink1 UTSW 11 70,502,261 (GRCm39) nonsense probably null
R6301:Mink1 UTSW 11 70,503,120 (GRCm39) missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70,500,419 (GRCm39) missense probably damaging 0.96
R6876:Mink1 UTSW 11 70,498,261 (GRCm39) missense probably benign 0.02
R7030:Mink1 UTSW 11 70,498,601 (GRCm39) missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70,503,158 (GRCm39) missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70,500,901 (GRCm39) splice site probably null
R7135:Mink1 UTSW 11 70,494,329 (GRCm39) missense probably damaging 1.00
R7238:Mink1 UTSW 11 70,502,305 (GRCm39) critical splice donor site probably null
R7320:Mink1 UTSW 11 70,489,899 (GRCm39) missense probably benign 0.23
R7396:Mink1 UTSW 11 70,495,994 (GRCm39) missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70,500,455 (GRCm39) missense probably benign 0.18
R7723:Mink1 UTSW 11 70,503,736 (GRCm39) missense probably benign 0.16
R7896:Mink1 UTSW 11 70,503,108 (GRCm39) missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70,494,594 (GRCm39) nonsense probably null
R8082:Mink1 UTSW 11 70,504,103 (GRCm39) missense possibly damaging 0.71
R8160:Mink1 UTSW 11 70,496,907 (GRCm39) nonsense probably null
R8335:Mink1 UTSW 11 70,500,401 (GRCm39) missense probably damaging 0.97
R8353:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8453:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8732:Mink1 UTSW 11 70,500,902 (GRCm39) critical splice acceptor site probably null
R9072:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9073:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9324:Mink1 UTSW 11 70,502,477 (GRCm39) missense probably damaging 0.98
R9596:Mink1 UTSW 11 70,497,915 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGCTTCGGAACAAGATCCTAC -3'
(R):5'- TGTCAGGTCCACCAGTAGAG -3'

Sequencing Primer
(F):5'- GCTTCGGAACAAGATCCTACACAATG -3'
(R):5'- CACCAGTAGAGGGCGGTG -3'
Posted On 2014-08-25