Incidental Mutation 'R2033:Olfr390'
ID221523
Institutional Source Beutler Lab
Gene Symbol Olfr390
Ensembl Gene ENSMUSG00000069818
Gene Nameolfactory receptor 390
SynonymsMOR135-26, GA_x6K02T2P1NL-3938806-3939741
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73782964-73790446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73787438 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 167 (S167P)
Ref Sequence ENSEMBL: ENSMUSP00000148992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092919] [ENSMUST00000120081] [ENSMUST00000206815] [ENSMUST00000215161]
Predicted Effect probably benign
Transcript: ENSMUST00000092919
AA Change: S167P

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000090598
Gene: ENSMUSG00000069818
AA Change: S167P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 6.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120081
AA Change: S167P

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113472
Gene: ENSMUSG00000069818
AA Change: S167P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 1.4e-36 PFAM
Pfam:7tm_4 139 283 5.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206815
Predicted Effect probably benign
Transcript: ENSMUST00000215161
AA Change: S167P

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Olfr390
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Olfr390 APN 11 73787580 missense probably damaging 1.00
IGL01621:Olfr390 APN 11 73787277 missense probably damaging 0.99
IGL01630:Olfr390 APN 11 73787861 missense probably benign 0.14
IGL01866:Olfr390 APN 11 73787828 missense probably benign 0.28
IGL02577:Olfr390 APN 11 73787046 missense probably damaging 1.00
IGL02617:Olfr390 APN 11 73787734 missense probably benign 0.01
IGL03017:Olfr390 APN 11 73787518 missense probably benign 0.01
IGL03215:Olfr390 APN 11 73787385 missense probably damaging 1.00
IGL03342:Olfr390 APN 11 73787483 missense probably benign 0.03
IGL03098:Olfr390 UTSW 11 73787703 missense probably benign 0.29
R0115:Olfr390 UTSW 11 73787315 missense possibly damaging 0.45
R0217:Olfr390 UTSW 11 73787388 missense possibly damaging 0.90
R1971:Olfr390 UTSW 11 73787790 missense probably damaging 1.00
R2058:Olfr390 UTSW 11 73787274 missense probably benign 0.00
R3051:Olfr390 UTSW 11 73787234 missense probably benign 0.01
R3622:Olfr390 UTSW 11 73787741 missense probably benign 0.00
R3913:Olfr390 UTSW 11 73787696 missense probably damaging 1.00
R4545:Olfr390 UTSW 11 73787166 missense probably damaging 1.00
R4656:Olfr390 UTSW 11 73787511 missense probably damaging 1.00
R5120:Olfr390 UTSW 11 73786964 missense probably benign 0.01
R5635:Olfr390 UTSW 11 73787634 missense probably benign 0.26
R6020:Olfr390 UTSW 11 73787552 missense probably benign 0.03
R6151:Olfr390 UTSW 11 73787695 nonsense probably null
R6885:Olfr390 UTSW 11 73787100 missense possibly damaging 0.94
R6984:Olfr390 UTSW 11 73787777 missense possibly damaging 0.91
R7057:Olfr390 UTSW 11 73787148 missense possibly damaging 0.88
R7120:Olfr390 UTSW 11 73787114 missense probably damaging 0.98
R7704:Olfr390 UTSW 11 73787790 missense probably damaging 1.00
R8323:Olfr390 UTSW 11 73786940 start codon destroyed probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGATGTCTGACACAAGTG -3'
(R):5'- CGAGTTGAAGGGACCTTGAG -3'

Sequencing Primer
(F):5'- TTTTTGCAGCCCTTGAGAAC -3'
(R):5'- TTGAAGGGACCTTGAGGATGG -3'
Posted On2014-08-25