Incidental Mutation 'R2033:Myo18a'
ID221526
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Namemyosin XVIIIA
SynonymsMyoPDZ
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77763246-77865980 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 77843099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000000645] [ENSMUST00000092884] [ENSMUST00000092887] [ENSMUST00000100794] [ENSMUST00000102488] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000108376] [ENSMUST00000130305] [ENSMUST00000130305] [ENSMUST00000130627] [ENSMUST00000130627] [ENSMUST00000164334] [ENSMUST00000167856] [ENSMUST00000168348] [ENSMUST00000169105] [ENSMUST00000172303] [ENSMUST00000172303]
Predicted Effect probably null
Transcript: ENSMUST00000000645
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000000645
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092884
SMART Domains Protein: ENSMUSP00000090560
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1534 2e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092887
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100443
Predicted Effect probably null
Transcript: ENSMUST00000100794
SMART Domains Protein: ENSMUSP00000098358
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 847 1.45e-46 SMART
IQ 848 870 1.11e-3 SMART
Pfam:Myosin_tail_1 884 1530 4.9e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102488
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102488
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108375
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108375
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108376
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108376
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130305
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130305
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130627
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130627
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134196
Predicted Effect probably null
Transcript: ENSMUST00000164334
SMART Domains Protein: ENSMUSP00000131771
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1505 4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167856
SMART Domains Protein: ENSMUSP00000128487
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 16 789 1.3e-32 SMART
IQ 790 812 1.11e-3 SMART
Blast:MYSc 865 994 1e-14 BLAST
low complexity region 1003 1014 N/A INTRINSIC
low complexity region 1387 1406 N/A INTRINSIC
internal_repeat_1 1569 1627 2.13e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000168348
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169105
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172303
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172303
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77847938 missense probably damaging 1.00
IGL00753:Myo18a APN 11 77825151 missense probably damaging 1.00
IGL01137:Myo18a APN 11 77827829 missense probably damaging 1.00
IGL01536:Myo18a APN 11 77820851 missense probably damaging 1.00
IGL01642:Myo18a APN 11 77864732 missense probably benign 0.07
IGL01728:Myo18a APN 11 77777856 missense probably damaging 0.99
IGL01780:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02286:Myo18a APN 11 77777985 nonsense probably null
IGL02350:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02357:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02420:Myo18a APN 11 77818693 missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77778172 missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77857852 splice site probably benign
IGL02869:Myo18a APN 11 77864786 missense probably damaging 1.00
IGL02869:Myo18a APN 11 77829873 splice site probably benign
IGL02962:Myo18a APN 11 77778235 missense probably damaging 1.00
IGL02963:Myo18a APN 11 77842018 splice site probably benign
IGL03410:Myo18a APN 11 77848004 missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77818770 missense probably benign 0.00
R0022:Myo18a UTSW 11 77843233 critical splice donor site probably null
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0098:Myo18a UTSW 11 77845765 missense probably damaging 1.00
R0322:Myo18a UTSW 11 77829800 missense probably damaging 1.00
R0373:Myo18a UTSW 11 77821042 missense probably benign 0.01
R0379:Myo18a UTSW 11 77850806 missense possibly damaging 0.84
R0513:Myo18a UTSW 11 77811594 intron probably benign
R0688:Myo18a UTSW 11 77824140 missense probably damaging 1.00
R0734:Myo18a UTSW 11 77847404 missense probably damaging 1.00
R0790:Myo18a UTSW 11 77840709 missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77818901 splice site probably null
R1103:Myo18a UTSW 11 77823330 missense probably damaging 1.00
R1183:Myo18a UTSW 11 77857745 missense probably damaging 1.00
R1216:Myo18a UTSW 11 77818647 missense probably benign 0.35
R1331:Myo18a UTSW 11 77841579 missense probably benign 0.28
R1479:Myo18a UTSW 11 77842194 missense probably benign 0.04
R1723:Myo18a UTSW 11 77853314 missense probably damaging 0.97
R1742:Myo18a UTSW 11 77841467 missense probably damaging 0.99
R1796:Myo18a UTSW 11 77829344 missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77825097 splice site probably benign
R1827:Myo18a UTSW 11 77818771 missense probably benign 0.00
R2043:Myo18a UTSW 11 77823363 missense probably damaging 0.99
R2105:Myo18a UTSW 11 77850234 missense probably benign
R2191:Myo18a UTSW 11 77818615 missense probably damaging 0.99
R2264:Myo18a UTSW 11 77819972 splice site probably benign
R2370:Myo18a UTSW 11 77777770 missense probably benign 0.03
R3015:Myo18a UTSW 11 77859020 intron probably benign
R3433:Myo18a UTSW 11 77818044 intron probably null
R3739:Myo18a UTSW 11 77845615 missense probably damaging 1.00
R3825:Myo18a UTSW 11 77777466 missense possibly damaging 0.47
R4056:Myo18a UTSW 11 77812013 missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77829708 missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77857787 missense probably damaging 1.00
R4620:Myo18a UTSW 11 77817947 missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77824136 missense probably damaging 1.00
R4647:Myo18a UTSW 11 77817950 missense probably damaging 1.00
R4701:Myo18a UTSW 11 77817665 missense probably damaging 1.00
R4729:Myo18a UTSW 11 77777685 unclassified probably null
R4731:Myo18a UTSW 11 77829759 missense probably benign 0.00
R4739:Myo18a UTSW 11 77823323 missense probably damaging 1.00
R4814:Myo18a UTSW 11 77859236 intron probably benign
R4889:Myo18a UTSW 11 77832412 missense probably damaging 1.00
R4988:Myo18a UTSW 11 77845521 critical splice donor site probably null
R5172:Myo18a UTSW 11 77824098 missense probably damaging 1.00
R5177:Myo18a UTSW 11 77864842 utr 3 prime probably benign
R5394:Myo18a UTSW 11 77853350 missense probably benign 0.14
R5643:Myo18a UTSW 11 77854687 missense probably benign 0.12
R5808:Myo18a UTSW 11 77829301 missense probably benign 0.34
R5871:Myo18a UTSW 11 77832480 missense probably damaging 1.00
R5936:Myo18a UTSW 11 77818213 missense probably damaging 1.00
R6017:Myo18a UTSW 11 77841523 missense probably damaging 0.96
R6053:Myo18a UTSW 11 77818176 missense probably damaging 1.00
R6271:Myo18a UTSW 11 77820809 missense probably damaging 1.00
R6486:Myo18a UTSW 11 77864822 missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77850852 missense probably damaging 0.99
R6884:Myo18a UTSW 11 77819049 missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77845515 missense probably benign 0.06
R6993:Myo18a UTSW 11 77859074 intron probably benign
R7071:Myo18a UTSW 11 77823827 missense probably damaging 1.00
R7074:Myo18a UTSW 11 77842561 missense probably benign 0.03
R7238:Myo18a UTSW 11 77842233 missense probably damaging 0.96
R7328:Myo18a UTSW 11 77807911 missense
R7527:Myo18a UTSW 11 77843580 missense probably benign 0.00
R7598:Myo18a UTSW 11 77847346 missense probably damaging 1.00
R7671:Myo18a UTSW 11 77859420 missense
Y5407:Myo18a UTSW 11 77777815 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CACTACGGTAATGACAAGGGC -3'
(R):5'- GCCAATAGATGTGGCACTGAG -3'

Sequencing Primer
(F):5'- TAATGACAAGGGCTACGGTCC -3'
(R):5'- ACTGAGCCCCAGCCTCAG -3'
Posted On2014-08-25