Incidental Mutation 'R2033:Eml5'
ID 221531
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.216) question?
Stock # R2033 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 98753064-98867743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98757645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1896 (E1896G)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000065716] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000223282] [ENSMUST00000221532]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000021399
SMART Domains Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 69 91 N/A INTRINSIC
ZnF_C3H1 170 193 7.16e-1 SMART
ZnF_C3H1 195 214 5.27e1 SMART
ZnF_C3H1 250 272 5.55e0 SMART
Pfam:zf-CCCH_2 273 290 1.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057000
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: E1849G

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: E1849G

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110104
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110105
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220848
Predicted Effect possibly damaging
Transcript: ENSMUST00000223282
AA Change: E1896G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221107
Predicted Effect probably benign
Transcript: ENSMUST00000222097
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98,839,468 (GRCm39) splice site probably benign
IGL00473:Eml5 APN 12 98,771,751 (GRCm39) splice site probably benign
IGL01120:Eml5 APN 12 98,810,278 (GRCm39) missense probably benign
IGL01308:Eml5 APN 12 98,768,572 (GRCm39) missense probably damaging 1.00
IGL01790:Eml5 APN 12 98,765,191 (GRCm39) missense probably damaging 1.00
IGL01973:Eml5 APN 12 98,829,539 (GRCm39) missense probably benign
IGL02182:Eml5 APN 12 98,768,581 (GRCm39) missense probably damaging 1.00
IGL02201:Eml5 APN 12 98,760,683 (GRCm39) splice site probably benign
IGL02375:Eml5 APN 12 98,810,346 (GRCm39) missense probably damaging 1.00
IGL02397:Eml5 APN 12 98,756,933 (GRCm39) missense probably benign 0.07
IGL02480:Eml5 APN 12 98,842,502 (GRCm39) missense probably damaging 1.00
IGL02801:Eml5 APN 12 98,784,104 (GRCm39) missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98,825,100 (GRCm39) missense probably damaging 1.00
IGL03104:Eml5 APN 12 98,827,504 (GRCm39) nonsense probably null
IGL03158:Eml5 APN 12 98,793,773 (GRCm39) splice site probably benign
IGL03286:Eml5 APN 12 98,826,762 (GRCm39) missense probably damaging 1.00
IGL03380:Eml5 APN 12 98,840,906 (GRCm39) splice site probably benign
BB010:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98,791,031 (GRCm39) splice site probably null
R0624:Eml5 UTSW 12 98,831,738 (GRCm39) missense probably damaging 1.00
R0993:Eml5 UTSW 12 98,827,442 (GRCm39) missense probably benign 0.25
R1073:Eml5 UTSW 12 98,797,232 (GRCm39) missense probably damaging 1.00
R1183:Eml5 UTSW 12 98,758,305 (GRCm39) missense probably benign 0.31
R1352:Eml5 UTSW 12 98,797,262 (GRCm39) splice site probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1503:Eml5 UTSW 12 98,797,433 (GRCm39) missense probably damaging 0.99
R1538:Eml5 UTSW 12 98,760,535 (GRCm39) missense probably damaging 0.99
R1689:Eml5 UTSW 12 98,797,194 (GRCm39) missense probably damaging 1.00
R1773:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1775:Eml5 UTSW 12 98,818,963 (GRCm39) splice site probably null
R1791:Eml5 UTSW 12 98,853,315 (GRCm39) missense probably benign 0.31
R1856:Eml5 UTSW 12 98,776,843 (GRCm39) missense probably damaging 1.00
R1919:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1957:Eml5 UTSW 12 98,826,220 (GRCm39) missense probably damaging 1.00
R1962:Eml5 UTSW 12 98,842,570 (GRCm39) missense probably damaging 0.99
R2035:Eml5 UTSW 12 98,760,525 (GRCm39) missense probably benign 0.33
R2073:Eml5 UTSW 12 98,768,705 (GRCm39) missense probably damaging 0.99
R2143:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2144:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2158:Eml5 UTSW 12 98,810,205 (GRCm39) splice site probably benign
R2164:Eml5 UTSW 12 98,853,356 (GRCm39) missense probably damaging 0.99
R2175:Eml5 UTSW 12 98,842,482 (GRCm39) nonsense probably null
R2200:Eml5 UTSW 12 98,791,676 (GRCm39) missense probably damaging 1.00
R2234:Eml5 UTSW 12 98,807,840 (GRCm39) missense probably damaging 1.00
R2504:Eml5 UTSW 12 98,810,364 (GRCm39) missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2958:Eml5 UTSW 12 98,842,437 (GRCm39) missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98,847,067 (GRCm39) splice site probably null
R3118:Eml5 UTSW 12 98,831,753 (GRCm39) missense probably damaging 0.97
R3735:Eml5 UTSW 12 98,822,248 (GRCm39) missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98,782,283 (GRCm39) missense probably damaging 1.00
R3900:Eml5 UTSW 12 98,791,782 (GRCm39) missense probably damaging 1.00
R3973:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R3976:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R4105:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4107:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4108:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4109:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4258:Eml5 UTSW 12 98,831,693 (GRCm39) missense probably benign 0.01
R4381:Eml5 UTSW 12 98,782,214 (GRCm39) missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98,803,600 (GRCm39) missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98,765,111 (GRCm39) missense probably damaging 1.00
R4775:Eml5 UTSW 12 98,768,566 (GRCm39) missense probably benign 0.05
R4850:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5007:Eml5 UTSW 12 98,797,224 (GRCm39) missense probably damaging 1.00
R5092:Eml5 UTSW 12 98,758,875 (GRCm39) missense probably damaging 1.00
R5123:Eml5 UTSW 12 98,840,771 (GRCm39) missense probably damaging 1.00
R5124:Eml5 UTSW 12 98,758,301 (GRCm39) missense probably damaging 1.00
R5273:Eml5 UTSW 12 98,756,947 (GRCm39) missense probably damaging 1.00
R5369:Eml5 UTSW 12 98,825,042 (GRCm39) missense probably damaging 1.00
R5430:Eml5 UTSW 12 98,760,417 (GRCm39) missense probably damaging 1.00
R5748:Eml5 UTSW 12 98,791,814 (GRCm39) missense probably damaging 0.99
R5769:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5832:Eml5 UTSW 12 98,842,447 (GRCm39) missense probably benign
R6113:Eml5 UTSW 12 98,790,933 (GRCm39) nonsense probably null
R6131:Eml5 UTSW 12 98,827,510 (GRCm39) missense probably damaging 0.99
R6175:Eml5 UTSW 12 98,760,715 (GRCm39) missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98,829,388 (GRCm39) missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98,837,143 (GRCm39) missense probably damaging 0.98
R6375:Eml5 UTSW 12 98,765,127 (GRCm39)
R6528:Eml5 UTSW 12 98,790,896 (GRCm39) missense probably benign 0.18
R6657:Eml5 UTSW 12 98,757,664 (GRCm39) missense probably damaging 0.98
R6717:Eml5 UTSW 12 98,793,765 (GRCm39) missense probably damaging 1.00
R6751:Eml5 UTSW 12 98,831,659 (GRCm39) missense probably damaging 1.00
R6833:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6834:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6972:Eml5 UTSW 12 98,842,439 (GRCm39) missense probably benign 0.00
R7091:Eml5 UTSW 12 98,768,733 (GRCm39) missense probably benign 0.16
R7353:Eml5 UTSW 12 98,791,683 (GRCm39) missense
R7644:Eml5 UTSW 12 98,822,203 (GRCm39) missense probably benign 0.05
R7694:Eml5 UTSW 12 98,758,822 (GRCm39) missense probably damaging 0.99
R7842:Eml5 UTSW 12 98,760,394 (GRCm39) missense probably damaging 1.00
R7933:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98,758,773 (GRCm39) critical splice donor site probably null
R8198:Eml5 UTSW 12 98,825,145 (GRCm39) nonsense probably null
R8482:Eml5 UTSW 12 98,842,560 (GRCm39) missense probably damaging 1.00
R8732:Eml5 UTSW 12 98,782,218 (GRCm39) missense probably damaging 0.99
R8956:Eml5 UTSW 12 98,818,952 (GRCm39) missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98,776,829 (GRCm39) missense probably damaging 0.99
R9131:Eml5 UTSW 12 98,825,099 (GRCm39) missense probably damaging 1.00
R9258:Eml5 UTSW 12 98,810,376 (GRCm39) missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98,822,287 (GRCm39) missense probably damaging 0.99
R9276:Eml5 UTSW 12 98,765,060 (GRCm39) missense probably damaging 0.99
R9301:Eml5 UTSW 12 98,848,292 (GRCm39) nonsense probably null
R9368:Eml5 UTSW 12 98,762,837 (GRCm39) missense probably benign 0.31
R9392:Eml5 UTSW 12 98,867,199 (GRCm39) missense probably damaging 1.00
R9393:Eml5 UTSW 12 98,842,433 (GRCm39) missense probably benign 0.35
R9449:Eml5 UTSW 12 98,827,554 (GRCm39) missense probably damaging 1.00
R9570:Eml5 UTSW 12 98,782,243 (GRCm39) missense probably benign 0.15
T0722:Eml5 UTSW 12 98,807,841 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACGTTCTAAAATATGTGGGAG -3'
(R):5'- GGCTCAACAAGTTCTTGAGAAG -3'

Sequencing Primer
(F):5'- GGAGGGTGACTCATCTAAGA -3'
(R):5'- GACCTTGAAGATTTCAGGCAC -3'
Posted On 2014-08-25