Incidental Mutation 'R2033:Tubb2a'
ID221534
Institutional Source Beutler Lab
Gene Symbol Tubb2a
Ensembl Gene ENSMUSG00000058672
Gene Nametubulin, beta 2A class IIA
Synonyms
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location34074274-34078007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34075456 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 117 (L117Q)
Ref Sequence ENSEMBL: ENSMUSP00000060246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040656] [ENSMUST00000056427]
Predicted Effect probably benign
Transcript: ENSMUST00000040656
SMART Domains Protein: ENSMUSP00000046168
Gene: ENSMUSG00000038286

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:Hydrolase_4 57 208 1.1e-10 PFAM
Pfam:Abhydrolase_1 61 205 2.8e-22 PFAM
Pfam:Abhydrolase_5 62 273 3.9e-20 PFAM
Pfam:Abhydrolase_6 63 285 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056427
AA Change: L117Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060246
Gene: ENSMUSG00000058672
AA Change: L117Q

DomainStartEndE-ValueType
Tubulin 47 244 1.64e-65 SMART
Tubulin_C 246 383 2.39e-49 SMART
low complexity region 431 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223251
Meta Mutation Damage Score 0.7893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, key participants in processes such as mitosis and intracellular transport, are composed of heterodimers of alpha- and beta-tubulins. The protein encoded by this gene is a beta-tubulin. Defects in this gene are associated with complex cortical dysplasia with other brain malformations-5. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Tubb2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:Tubb2a APN 13 34076547 critical splice donor site probably null
R0233:Tubb2a UTSW 13 34075342 missense possibly damaging 0.50
R0233:Tubb2a UTSW 13 34075342 missense possibly damaging 0.50
R0345:Tubb2a UTSW 13 34076637 missense probably benign
R3732:Tubb2a UTSW 13 34075264 missense probably damaging 1.00
R3836:Tubb2a UTSW 13 34075311 missense probably benign 0.30
R3837:Tubb2a UTSW 13 34075311 missense probably benign 0.30
R3839:Tubb2a UTSW 13 34075311 missense probably benign 0.30
R4879:Tubb2a UTSW 13 34074589 missense probably benign 0.02
R4936:Tubb2a UTSW 13 34075257 nonsense probably null
R5537:Tubb2a UTSW 13 34075451 missense probably benign 0.07
R5889:Tubb2a UTSW 13 34075468 missense possibly damaging 0.92
R6102:Tubb2a UTSW 13 34075343 missense probably benign 0.00
R6475:Tubb2a UTSW 13 34075459 missense possibly damaging 0.91
R7206:Tubb2a UTSW 13 34075522 missense possibly damaging 0.80
R7254:Tubb2a UTSW 13 34074532 missense probably damaging 1.00
R7260:Tubb2a UTSW 13 34075414 missense probably damaging 1.00
R7631:Tubb2a UTSW 13 34075244 missense probably damaging 0.99
R7734:Tubb2a UTSW 13 34074793 missense probably benign 0.06
R7815:Tubb2a UTSW 13 34074979 missense probably benign 0.10
R7850:Tubb2a UTSW 13 34074571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCAGAGACCTTGGGTGAGGG -3'
(R):5'- AGGTCCCTGGATACACTGAC -3'

Sequencing Primer
(F):5'- GCATGACGCTGAAGGTGTTC -3'
(R):5'- GTCCCTGGATACACTGACAATATTTC -3'
Posted On2014-08-25