Incidental Mutation 'R1975:Fblim1'
ID221541
Institutional Source Beutler Lab
Gene Symbol Fblim1
Ensembl Gene ENSMUSG00000006219
Gene Namefilamin binding LIM protein 1
Synonyms
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1975 (G1)
Quality Score216
Status Validated
Chromosome4
Chromosomal Location141576062-141606096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141584864 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 183 (D183E)
Ref Sequence ENSEMBL: ENSMUSP00000101411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006381] [ENSMUST00000105784] [ENSMUST00000105785] [ENSMUST00000130181] [ENSMUST00000141518] [ENSMUST00000147764] [ENSMUST00000153189]
Predicted Effect probably damaging
Transcript: ENSMUST00000006381
AA Change: D183E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006381
Gene: ENSMUSG00000006219
AA Change: D183E

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105784
AA Change: D183E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101410
Gene: ENSMUSG00000006219
AA Change: D183E

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105785
AA Change: D183E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101411
Gene: ENSMUSG00000006219
AA Change: D183E

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130181
SMART Domains Protein: ENSMUSP00000115992
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141518
SMART Domains Protein: ENSMUSP00000123669
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147764
SMART Domains Protein: ENSMUSP00000120600
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153189
SMART Domains Protein: ENSMUSP00000123322
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit severe osteopenia with decreased osteoblasts and increased osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Fblim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02634:Fblim1 APN 4 141583111 missense probably benign 0.43
IGL03036:Fblim1 APN 4 141583124 missense possibly damaging 0.65
IGL02802:Fblim1 UTSW 4 141590120 missense possibly damaging 0.90
PIT4377001:Fblim1 UTSW 4 141595409 missense probably damaging 1.00
R0840:Fblim1 UTSW 4 141581009 missense possibly damaging 0.88
R1793:Fblim1 UTSW 4 141595238 missense probably damaging 1.00
R4829:Fblim1 UTSW 4 141584709 missense probably damaging 1.00
R6066:Fblim1 UTSW 4 141577909 missense probably damaging 1.00
R6101:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6126:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6127:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6128:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R7525:Fblim1 UTSW 4 141590080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGCTCAGTCAGTGCAAC -3'
(R):5'- TGAAGGCCAACTCTGCTTTC -3'

Sequencing Primer
(F):5'- GCTACATGCAGGGGAGTACC -3'
(R):5'- GAAGGCCAACTCTGCTTTCTTTTC -3'
Posted On2014-08-25