Mutagenetix > Incidental Mutation

Incidental Mutation 'R2033:Atp6v1c1'

221542

Institutional Source

Beutler Lab

Gene Symbol

Atp6v1c1

Ensembl Gene

ENSMUSG00000022295

Gene Name

ATPase, H+ transporting, lysosomal V1 subunit C1

Synonyms

1700025B18Rik

MMRRC Submission

040040-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2033 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38661933-38692446 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 38673966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022904] [ENSMUST00000226533] [ENSMUST00000228820]

AlphaFold

Q9Z1G3

Predicted Effect

probably null
Transcript: ENSMUST00000022904

SMART Domains

Protein: ENSMUSP00000022904
Gene: ENSMUSG00000022295

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_C	4	370	1.2e-168	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226487

Predicted Effect

probably benign
Transcript: ENSMUST00000226533

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228475

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228486

Predicted Effect

probably benign
Transcript: ENSMUST00000228820

Meta Mutation Damage Score

0.9503

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	T	C	4: 144,456,383	T172A	probably benign	Het
Bpifc	G	A	10: 86,000,632	T3I	possibly damaging	Het
Car12	A	G	9: 66,717,558		probably null	Het
Ccrl2	A	G	9: 111,055,870	F187L	possibly damaging	Het
Cep250	G	A	2: 155,970,892	R544H	probably damaging	Het
Col4a3	T	G	1: 82,718,011		probably benign	Het
Cyb5r2	T	C	7: 107,756,907		probably null	Het
Elfn2	A	G	15: 78,671,896	V817A	probably damaging	Het
Eln	C	T	5: 134,710,106		probably null	Het
Eml5	T	C	12: 98,791,386	E1896G	possibly damaging	Het
G530012D18Rik	CACAGA	CA	1: 85,577,154		probably null	Het
Galnt11	C	T	5: 25,247,538	T16I	probably damaging	Het
Gars	C	T	6: 55,077,723	H672Y	probably benign	Het
Gpr155	T	A	2: 73,348,182	H726L	probably benign	Het
Inpp1	T	A	1: 52,790,173	N229I	possibly damaging	Het
Isg20	A	C	7: 78,916,533	I77L	probably damaging	Het
Kit	G	C	5: 75,637,317	D422H	possibly damaging	Het
Lonp2	A	G	8: 86,708,942	E602G	possibly damaging	Het
Mink1	T	C	11: 70,612,508	V1143A	probably damaging	Het
Myh6	A	C	14: 54,963,645	L120R	probably benign	Het
Myo18a	T	A	11: 77,843,099		probably null	Het
Nphs2	T	C	1: 156,323,738	V249A	probably damaging	Het
Npsr1	A	G	9: 24,313,352	K342E	probably benign	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Nudt18	G	T	14: 70,579,616	G162V	possibly damaging	Het
Odam	A	G	5: 87,892,419	D248G	probably benign	Het
Olfr1224-ps1	A	G	2: 89,157,154	V7A	probably damaging	Het
Olfr147	G	T	9: 38,403,373	M166I	probably damaging	Het
Olfr390	T	C	11: 73,787,438	S167P	probably benign	Het
Olfr557	A	G	7: 102,699,162	E308G	probably benign	Het
Olfr572	T	C	7: 102,928,408	V260A	probably benign	Het
Pde4b	G	T	4: 102,605,295	D723Y	probably benign	Het
Pdzrn3	T	C	6: 101,150,954	E917G	probably damaging	Het
Ppip5k1	C	T	2: 121,337,627	R715H	probably damaging	Het
Prkdc	T	A	16: 15,687,352		probably benign	Het
Ptp4a3	A	G	15: 73,753,769	Y21C	probably damaging	Het
Ptprk	C	A	10: 28,592,767		probably benign	Het
Rfesd	C	A	13: 76,002,872		probably null	Het
Rtel1	A	T	2: 181,351,863	K592*	probably null	Het
Siah1a	T	A	8: 86,725,270	K195N	probably damaging	Het
Slc5a5	G	T	8: 70,888,587	D369E	probably damaging	Het
Slc6a6	A	T	6: 91,724,910	I100F	probably benign	Het
Smtn	T	C	11: 3,517,781	I913V	probably benign	Het
Stk17b	A	G	1: 53,761,076	S248P	probably damaging	Het
Sun1	C	T	5: 139,225,438	H149Y	probably damaging	Het
Taar5	T	C	10: 23,971,094	I130T	possibly damaging	Het
Tmem132b	G	T	5: 125,749,289	V448F	probably damaging	Het
Tmem94	C	A	11: 115,794,328	N888K	possibly damaging	Het
Trpc1	T	C	9: 95,706,843	N742S	probably damaging	Het
Ttbk2	T	C	2: 120,806,849	T112A	probably damaging	Het
Tubb2a	A	T	13: 34,075,456	L117Q	probably damaging	Het
Vmn1r60	T	A	7: 5,544,820	M94L	probably benign	Het
Vmn2r83	A	G	10: 79,491,819	T754A	probably benign	Het

Other mutations in Atp6v1c1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Atp6v1c1	APN	15	38686856	missense	probably damaging	0.99
IGL01371:Atp6v1c1	APN	15	38682960	missense	probably benign
IGL02987:Atp6v1c1	APN	15	38690562	missense	possibly damaging	0.70
P0029:Atp6v1c1	UTSW	15	38686902	unclassified	probably benign
R0550:Atp6v1c1	UTSW	15	38682929	splice site	probably benign
R0669:Atp6v1c1	UTSW	15	38677528	missense	probably benign	0.00
R3021:Atp6v1c1	UTSW	15	38689216	missense	possibly damaging	0.75
R4475:Atp6v1c1	UTSW	15	38677573	missense	probably benign	0.03
R4612:Atp6v1c1	UTSW	15	38677612	missense	probably damaging	1.00
R4798:Atp6v1c1	UTSW	15	38689176	missense	probably damaging	1.00
R5095:Atp6v1c1	UTSW	15	38679413	critical splice donor site	probably null
R5600:Atp6v1c1	UTSW	15	38686863	missense	probably benign	0.17
R6177:Atp6v1c1	UTSW	15	38673928	nonsense	probably null
R6434:Atp6v1c1	UTSW	15	38677546	missense	probably damaging	0.99
R6916:Atp6v1c1	UTSW	15	38677581	missense	probably benign	0.00
R6973:Atp6v1c1	UTSW	15	38690550	missense	probably damaging	1.00
R7395:Atp6v1c1	UTSW	15	38691705	makesense	probably null
R7607:Atp6v1c1	UTSW	15	38683011	critical splice donor site	probably null
R7712:Atp6v1c1	UTSW	15	38686805	missense	probably benign	0.00
R8830:Atp6v1c1	UTSW	15	38677545	missense	probably damaging	0.98
R9195:Atp6v1c1	UTSW	15	38673954	missense	probably damaging	1.00
R9640:Atp6v1c1	UTSW	15	38689137	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAGACCCTTCAGATAAAGATACACC -3'
(R):5'- CATGAACATGCTTGAACCATAGG -3'

Sequencing Primer
(F):5'- GGCTCATCTGGATCACACAGTAAG -3'
(R):5'- TGAACCATAGGTGCACATGTG -3'

Posted On

2014-08-25