Incidental Mutation 'R2033:Ptp4a3'
ID 221544
Institutional Source Beutler Lab
Gene Symbol Ptp4a3
Ensembl Gene ENSMUSG00000059895
Gene Name protein tyrosine phosphatase 4a3
Synonyms Prl-3
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 73594991-73629075 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73625618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 21 (Y21C)
Ref Sequence ENSEMBL: ENSMUSP00000131036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053232] [ENSMUST00000163582] [ENSMUST00000165541] [ENSMUST00000167582] [ENSMUST00000230044] [ENSMUST00000230177] [ENSMUST00000230307] [ENSMUST00000231209]
AlphaFold Q9D658
Predicted Effect probably damaging
Transcript: ENSMUST00000053232
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060956
Gene: ENSMUSG00000059895
AA Change: Y40C

DomainStartEndE-ValueType
Pfam:DSPc 26 155 7.1e-10 PFAM
Pfam:Y_phosphatase 27 153 3.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163582
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131281
Gene: ENSMUSG00000059895
AA Change: Y40C

DomainStartEndE-ValueType
Pfam:DSPc 26 155 7.1e-10 PFAM
Pfam:Y_phosphatase 27 153 3.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165541
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132097
Gene: ENSMUSG00000059895
AA Change: Y40C

DomainStartEndE-ValueType
Pfam:Y_phosphatase 13 152 5.1e-9 PFAM
Pfam:DSPc 34 154 4.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167582
AA Change: Y21C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131036
Gene: ENSMUSG00000059895
AA Change: Y21C

DomainStartEndE-ValueType
Pfam:Y_phosphatase 5 134 7.8e-12 PFAM
Pfam:DSPc 5 136 1.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229339
Predicted Effect probably benign
Transcript: ENSMUST00000230044
Predicted Effect probably damaging
Transcript: ENSMUST00000230177
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000230307
Predicted Effect probably benign
Transcript: ENSMUST00000231209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230864
Meta Mutation Damage Score 0.8586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. Protein tyrosine phosphatases are cell signaling molecules that play regulatory roles in a variety of cellular processes. Studies of this class of protein tyrosine phosphatase in mice demonstrates that they are prenylated in vivo, suggesting their association with cell plasma membrane. The encoded protein may enhance cell proliferation, and overexpression of this gene has been implicated in tumor metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality and decreased incidence of AOM-DDS induced tumors. Mice homozygous for a different targeted allele exhibit decreased circulating glucose levels in an intraperitoneal glucose tolerance test. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(9)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Ptp4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Ptp4a3 UTSW 15 73,627,160 (GRCm39) missense possibly damaging 0.95
R2159:Ptp4a3 UTSW 15 73,623,865 (GRCm39) missense probably benign 0.00
R5976:Ptp4a3 UTSW 15 73,627,885 (GRCm39) missense possibly damaging 0.89
R6874:Ptp4a3 UTSW 15 73,595,259 (GRCm39) unclassified probably benign
R7894:Ptp4a3 UTSW 15 73,628,756 (GRCm39) missense probably benign 0.02
R8168:Ptp4a3 UTSW 15 73,628,695 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGTCTCAAGGGAAGC -3'
(R):5'- AGGGTTGATGACTTTCTCACAG -3'

Sequencing Primer
(F):5'- CTTGTCTCAAGGGAAGCAGCTTG -3'
(R):5'- GGGTTGATGACTTTCTCACAGTCATC -3'
Posted On 2014-08-25