Incidental Mutation 'R2033:Ptp4a3'
ID221544
Institutional Source Beutler Lab
Gene Symbol Ptp4a3
Ensembl Gene ENSMUSG00000059895
Gene Nameprotein tyrosine phosphatase 4a3
SynonymsPrl-3
MMRRC Submission 040040-MU
Accession Numbers

NCBI RefSeq: NM_001166388.1; MGI: 1277098

Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location73723145-73758766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73753769 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 21 (Y21C)
Ref Sequence ENSEMBL: ENSMUSP00000131036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053232] [ENSMUST00000163582] [ENSMUST00000165541] [ENSMUST00000167582] [ENSMUST00000230044] [ENSMUST00000230177] [ENSMUST00000230307] [ENSMUST00000231209]
Predicted Effect probably damaging
Transcript: ENSMUST00000053232
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060956
Gene: ENSMUSG00000059895
AA Change: Y40C

DomainStartEndE-ValueType
Pfam:DSPc 26 155 7.1e-10 PFAM
Pfam:Y_phosphatase 27 153 3.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163582
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131281
Gene: ENSMUSG00000059895
AA Change: Y40C

DomainStartEndE-ValueType
Pfam:DSPc 26 155 7.1e-10 PFAM
Pfam:Y_phosphatase 27 153 3.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165541
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132097
Gene: ENSMUSG00000059895
AA Change: Y40C

DomainStartEndE-ValueType
Pfam:Y_phosphatase 13 152 5.1e-9 PFAM
Pfam:DSPc 34 154 4.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167582
AA Change: Y21C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131036
Gene: ENSMUSG00000059895
AA Change: Y21C

DomainStartEndE-ValueType
Pfam:Y_phosphatase 5 134 7.8e-12 PFAM
Pfam:DSPc 5 136 1.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229339
Predicted Effect probably benign
Transcript: ENSMUST00000230044
Predicted Effect probably damaging
Transcript: ENSMUST00000230177
AA Change: Y40C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000230307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230864
Predicted Effect probably benign
Transcript: ENSMUST00000231209
Meta Mutation Damage Score 0.8586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. Protein tyrosine phosphatases are cell signaling molecules that play regulatory roles in a variety of cellular processes. Studies of this class of protein tyrosine phosphatase in mice demonstrates that they are prenylated in vivo, suggesting their association with cell plasma membrane. The encoded protein may enhance cell proliferation, and overexpression of this gene has been implicated in tumor metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality and decreased incidence of AOM-DDS induced tumors. Mice homozygous for a different targeted allele exhibit decreased circulating glucose levels in an intraperitoneal glucose tolerance test. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(9)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Ptp4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Ptp4a3 UTSW 15 73755311 missense possibly damaging 0.95
R2159:Ptp4a3 UTSW 15 73752016 missense probably benign 0.00
R5976:Ptp4a3 UTSW 15 73756036 missense possibly damaging 0.89
R6874:Ptp4a3 UTSW 15 73723410 unclassified probably benign
R7894:Ptp4a3 UTSW 15 73756907 missense probably benign 0.02
R8168:Ptp4a3 UTSW 15 73756846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGTCTCAAGGGAAGC -3'
(R):5'- AGGGTTGATGACTTTCTCACAG -3'

Sequencing Primer
(F):5'- CTTGTCTCAAGGGAAGCAGCTTG -3'
(R):5'- GGGTTGATGACTTTCTCACAGTCATC -3'
Posted On2014-08-25