Incidental Mutation 'R2033:Elfn2'
ID 221545
Institutional Source Beutler Lab
Gene Symbol Elfn2
Ensembl Gene ENSMUSG00000043460
Gene Name leucine rich repeat and fibronectin type III, extracellular 2
Synonyms Lrrc62
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R2033 (G1)
Quality Score 125
Status Validated
Chromosome 15
Chromosomal Location 78551531-78602971 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78556096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 817 (V817A)
Ref Sequence ENSEMBL: ENSMUSP00000155111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088592] [ENSMUST00000229441]
AlphaFold Q68FM6
Predicted Effect probably damaging
Transcript: ENSMUST00000088592
AA Change: V817A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085960
Gene: ENSMUSG00000043460
AA Change: V817A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRR 78 101 9.96e-1 SMART
LRR 103 125 5.56e0 SMART
LRR 126 149 6.96e0 SMART
LRR 150 173 1.66e1 SMART
LRRCT 185 240 9.74e-2 SMART
FN3 293 371 4.56e0 SMART
transmembrane domain 397 419 N/A INTRINSIC
low complexity region 583 598 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
low complexity region 686 696 N/A INTRINSIC
low complexity region 754 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229441
AA Change: V817A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230478
Meta Mutation Damage Score 0.4494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Ppip5k1 C T 2: 121,168,108 (GRCm39) R715H probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Elfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Elfn2 APN 15 78,556,618 (GRCm39) missense possibly damaging 0.88
IGL02165:Elfn2 APN 15 78,557,618 (GRCm39) missense probably benign 0.04
IGL02951:Elfn2 APN 15 78,556,082 (GRCm39) missense probably damaging 1.00
IGL03402:Elfn2 APN 15 78,557,670 (GRCm39) missense possibly damaging 0.50
R0083:Elfn2 UTSW 15 78,557,614 (GRCm39) missense probably damaging 1.00
R0441:Elfn2 UTSW 15 78,557,795 (GRCm39) missense probably benign 0.09
R0570:Elfn2 UTSW 15 78,557,434 (GRCm39) missense probably damaging 1.00
R1155:Elfn2 UTSW 15 78,557,344 (GRCm39) missense probably benign 0.03
R1670:Elfn2 UTSW 15 78,556,568 (GRCm39) missense probably benign 0.05
R2138:Elfn2 UTSW 15 78,558,238 (GRCm39) missense probably benign 0.05
R2167:Elfn2 UTSW 15 78,556,646 (GRCm39) missense probably benign 0.09
R2226:Elfn2 UTSW 15 78,558,443 (GRCm39) missense probably damaging 1.00
R2497:Elfn2 UTSW 15 78,558,464 (GRCm39) missense probably damaging 1.00
R5175:Elfn2 UTSW 15 78,558,073 (GRCm39) missense probably damaging 1.00
R5215:Elfn2 UTSW 15 78,558,401 (GRCm39) missense probably damaging 1.00
R5588:Elfn2 UTSW 15 78,558,076 (GRCm39) missense probably damaging 1.00
R7291:Elfn2 UTSW 15 78,557,183 (GRCm39) missense probably benign 0.21
R7760:Elfn2 UTSW 15 78,558,041 (GRCm39) missense probably benign 0.00
R7893:Elfn2 UTSW 15 78,557,368 (GRCm39) missense probably damaging 1.00
R8018:Elfn2 UTSW 15 78,557,968 (GRCm39) missense probably damaging 1.00
R8084:Elfn2 UTSW 15 78,556,660 (GRCm39) missense probably damaging 0.98
R8112:Elfn2 UTSW 15 78,557,635 (GRCm39) missense probably damaging 0.97
R8501:Elfn2 UTSW 15 78,558,500 (GRCm39) missense probably benign
R8717:Elfn2 UTSW 15 78,556,561 (GRCm39) missense probably benign 0.01
R8961:Elfn2 UTSW 15 78,557,378 (GRCm39) missense probably benign 0.00
R9001:Elfn2 UTSW 15 78,557,438 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ACAGTCAGGTGGTGGTCAAG -3'
(R):5'- ACTACTCAGGGTACTCCTCCAG -3'

Sequencing Primer
(F):5'- CAGGTGGTGGTCAAGTGTGTG -3'
(R):5'- TCCAGCCCCGAGTACTC -3'
Posted On 2014-08-25