Incidental Mutation 'R2033:Nrros'
ID221549
Institutional Source Beutler Lab
Gene Symbol Nrros
Ensembl Gene ENSMUSG00000052384
Gene Namenegative regulator of reactive oxygen species
SynonymsLrrc33, E430025L02Rik
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32142785-32165594 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 32144157 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 311 (W311*)
Ref Sequence ENSEMBL: ENSMUSP00000155965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099991] [ENSMUST00000115163] [ENSMUST00000115165] [ENSMUST00000126869] [ENSMUST00000130410] [ENSMUST00000143682] [ENSMUST00000144345] [ENSMUST00000231836]
Predicted Effect probably null
Transcript: ENSMUST00000099991
AA Change: W319*
SMART Domains Protein: ENSMUSP00000097571
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115163
AA Change: W347*
SMART Domains Protein: ENSMUSP00000110817
Gene: ENSMUSG00000052384
AA Change: W347*

DomainStartEndE-ValueType
LRRNT 59 89 1.05e1 SMART
LRR 108 131 1.01e2 SMART
LRR 159 183 5.27e1 SMART
LRR 184 207 4.05e-1 SMART
LRR_TYP 208 231 7.67e-2 SMART
LRR 232 255 1.49e1 SMART
LRR_TYP 355 378 1.67e-2 SMART
LRR 404 428 3.27e1 SMART
LRR_TYP 429 452 1.79e-2 SMART
LRR 489 512 1.45e1 SMART
LRR 563 584 1.76e1 SMART
LRR 587 608 3.36e1 SMART
transmembrane domain 681 703 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115165
AA Change: W295*
SMART Domains Protein: ENSMUSP00000110819
Gene: ENSMUSG00000052384
AA Change: W295*

DomainStartEndE-ValueType
Blast:LRRNT 8 37 5e-8 BLAST
LRR 56 79 1.01e2 SMART
LRR 107 131 5.27e1 SMART
LRR 132 155 4.05e-1 SMART
LRR_TYP 156 179 7.67e-2 SMART
LRR 180 203 1.49e1 SMART
LRR_TYP 303 326 1.67e-2 SMART
LRR 352 376 3.27e1 SMART
LRR_TYP 377 400 1.79e-2 SMART
LRR 437 460 1.45e1 SMART
LRR 511 532 1.76e1 SMART
LRR 535 556 3.36e1 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126869
AA Change: W319*
SMART Domains Protein: ENSMUSP00000116388
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127287
Predicted Effect probably benign
Transcript: ENSMUST00000130410
SMART Domains Protein: ENSMUSP00000122290
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Pfam:LRR_7 81 97 1.9e-2 PFAM
Pfam:LRR_7 105 121 6.8e-2 PFAM
Pfam:LRR_7 133 144 2e-1 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136809
Predicted Effect probably null
Transcript: ENSMUST00000143682
AA Change: W319*
SMART Domains Protein: ENSMUSP00000119349
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144345
SMART Domains Protein: ENSMUSP00000121492
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150250
Predicted Effect probably null
Transcript: ENSMUST00000231836
AA Change: W311*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased oxidative stress and susceptibility to experimental autoimmune encephalomyelitis, but to reduced susceptibility to bacterial infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Nrros
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Nrros APN 16 32147620 missense probably benign 0.06
IGL01097:Nrros APN 16 32144185 missense possibly damaging 0.71
IGL02065:Nrros APN 16 32144674 missense possibly damaging 0.84
IGL03372:Nrros APN 16 32144770 missense probably damaging 1.00
R0615:Nrros UTSW 16 32144085 missense probably damaging 1.00
R0669:Nrros UTSW 16 32143423 missense probably damaging 1.00
R0840:Nrros UTSW 16 32143423 missense probably damaging 1.00
R1398:Nrros UTSW 16 32143144 missense probably damaging 0.98
R1796:Nrros UTSW 16 32143511 missense probably damaging 1.00
R2031:Nrros UTSW 16 32144157 nonsense probably null
R2034:Nrros UTSW 16 32144157 nonsense probably null
R2087:Nrros UTSW 16 32144157 nonsense probably null
R2089:Nrros UTSW 16 32144157 nonsense probably null
R2090:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2151:Nrros UTSW 16 32143258 missense probably benign 0.11
R2438:Nrros UTSW 16 32144111 unclassified probably null
R2438:Nrros UTSW 16 32144299 missense probably benign 0.25
R5474:Nrros UTSW 16 32144352 missense probably benign 0.00
R5527:Nrros UTSW 16 32144470 missense probably damaging 1.00
R5629:Nrros UTSW 16 32144405 missense probably damaging 1.00
R5888:Nrros UTSW 16 32143087 missense probably benign 0.15
R5939:Nrros UTSW 16 32143454 missense probably benign 0.01
R5982:Nrros UTSW 16 32144593 missense probably damaging 0.96
R6869:Nrros UTSW 16 32144431 missense probably damaging 1.00
R6912:Nrros UTSW 16 32162239 missense probably null 0.01
R7010:Nrros UTSW 16 32143580 missense probably damaging 0.96
R7469:Nrros UTSW 16 32144212 missense probably benign 0.14
R7673:Nrros UTSW 16 32162281 missense unknown
R7770:Nrros UTSW 16 32143528 missense probably benign 0.01
X0022:Nrros UTSW 16 32143040 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CAACTGGTTGTGGCTCAGATCC -3'
(R):5'- ACTGGACCTGTCTCACAACC -3'

Sequencing Primer
(F):5'- GTTGTGGCTCAGATCCAGCTC -3'
(R):5'- TGTCTCACAACCAGCTGC -3'
Posted On2014-08-25