Incidental Mutation 'R2044:Lonrf2'
ID 221554
Institutional Source Beutler Lab
Gene Symbol Lonrf2
Ensembl Gene ENSMUSG00000048814
Gene Name LON peptidase N-terminal domain and ring finger 2
Synonyms 2900060P06Rik
MMRRC Submission 040051-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R2044 (G1)
Quality Score 176
Status Validated
Chromosome 1
Chromosomal Location 38832750-38875768 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38846131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 347 (E347G)
Ref Sequence ENSEMBL: ENSMUSP00000117600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039612] [ENSMUST00000147695]
AlphaFold F6ZE64
Predicted Effect probably benign
Transcript: ENSMUST00000039612
AA Change: E347G

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047372
Gene: ENSMUSG00000048814
AA Change: E347G

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON 301 498 4.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147695
AA Change: E347G

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117600
Gene: ENSMUSG00000048814
AA Change: E347G

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON_substr_bdg 301 498 2.6e-27 PFAM
Meta Mutation Damage Score 0.1565 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,288,986 (GRCm39) probably benign Het
Abhd15 A G 11: 77,409,164 (GRCm39) T293A probably benign Het
Aldh1l1 C T 6: 90,539,647 (GRCm39) P192L probably benign Het
Aldoart1 T G 4: 72,770,779 (GRCm39) I10L probably benign Het
Ankhd1 G A 18: 36,778,166 (GRCm39) G1653D probably benign Het
Ankk1 A C 9: 49,330,664 (GRCm39) probably null Het
Astn1 A G 1: 158,428,072 (GRCm39) T748A possibly damaging Het
Bmp7 C A 2: 172,781,708 (GRCm39) R52L possibly damaging Het
Ccdc33 G A 9: 57,938,395 (GRCm39) P859S possibly damaging Het
Ccny A G 18: 9,449,644 (GRCm39) S10P probably damaging Het
Cdc6 C A 11: 98,801,287 (GRCm39) F179L probably benign Het
Cdc7 T A 5: 107,130,998 (GRCm39) V491E probably benign Het
Cdh23 G T 10: 60,432,509 (GRCm39) S138R possibly damaging Het
Cenpc1 T C 5: 86,185,614 (GRCm39) H299R probably benign Het
Ciart A T 3: 95,786,013 (GRCm39) M354K probably benign Het
Clasrp G T 7: 19,320,640 (GRCm39) probably benign Het
Col4a3 G A 1: 82,674,040 (GRCm39) G1132E unknown Het
Crebbp G A 16: 3,902,687 (GRCm39) T2184I probably benign Het
Cyp2r1 A C 7: 114,149,640 (GRCm39) M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 (GRCm39) R27M probably null Het
Ddhd2 A G 8: 26,242,192 (GRCm39) F116L probably damaging Het
Dgkd G A 1: 87,855,413 (GRCm39) R685K probably benign Het
Dnah2 A G 11: 69,415,066 (GRCm39) S223P probably benign Het
Exph5 A T 9: 53,283,979 (GRCm39) R353S possibly damaging Het
F11 C A 8: 45,705,155 (GRCm39) V129F probably benign Het
F830045P16Rik A T 2: 129,301,317 (GRCm39) S454T possibly damaging Het
Fam124a T C 14: 62,824,656 (GRCm39) I50T probably damaging Het
Fam20c T C 5: 138,741,982 (GRCm39) probably null Het
Fam234b A G 6: 135,203,912 (GRCm39) T405A probably benign Het
Fbh1 C A 2: 11,767,781 (GRCm39) V356L possibly damaging Het
Flywch1 G A 17: 23,981,287 (GRCm39) Q132* probably null Het
Foxo6 T C 4: 120,144,166 (GRCm39) D95G probably benign Het
Ggt5 T C 10: 75,439,921 (GRCm39) F174S probably damaging Het
Gm7104 G A 12: 88,252,551 (GRCm39) noncoding transcript Het
Gpr155 A G 2: 73,203,977 (GRCm39) L279P probably damaging Het
H2-T23 A G 17: 36,343,083 (GRCm39) L98P probably damaging Het
H4c16 G C 6: 136,781,101 (GRCm39) R93G possibly damaging Het
Heatr5a A G 12: 52,002,186 (GRCm39) V250A probably benign Het
Heyl A T 4: 123,135,156 (GRCm39) I50F probably damaging Het
Ifitm10 A T 7: 141,909,771 (GRCm39) S179R probably damaging Het
Isg15 A T 4: 156,284,249 (GRCm39) I93N probably benign Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itga10 G A 3: 96,565,006 (GRCm39) V985I probably benign Het
Kcnt2 T C 1: 140,302,892 (GRCm39) I144T probably benign Het
Klk1 A C 7: 43,878,458 (GRCm39) K104T possibly damaging Het
Lemd3 C A 10: 120,769,347 (GRCm39) R654L probably damaging Het
Lmod1 A T 1: 135,292,125 (GRCm39) M327L probably benign Het
Ltbp1 A G 17: 75,583,427 (GRCm39) Y409C probably damaging Het
Mecom A T 3: 30,034,741 (GRCm39) Y312N probably damaging Het
Mmut A G 17: 41,252,342 (GRCm39) T295A probably benign Het
Mrgprb3 C T 7: 48,293,482 (GRCm39) C23Y possibly damaging Het
Nadk C A 4: 155,669,898 (GRCm39) L194I probably damaging Het
Naxd A G 8: 11,559,510 (GRCm39) I182V probably benign Het
Nbeal1 T A 1: 60,358,846 (GRCm39) I1176K probably damaging Het
Nol4l C A 2: 153,371,441 (GRCm39) R81L possibly damaging Het
Odad3 T G 9: 21,903,154 (GRCm39) T419P possibly damaging Het
Or4k47 T A 2: 111,452,159 (GRCm39) R87W probably benign Het
Or8g36 A T 9: 39,422,674 (GRCm39) M114K probably damaging Het
Or9s15 G T 1: 92,524,691 (GRCm39) R150L probably benign Het
Pcdh18 A G 3: 49,709,389 (GRCm39) V642A probably benign Het
Pdzk1 G A 3: 96,763,164 (GRCm39) probably benign Het
Per3 C T 4: 151,118,395 (GRCm39) V233I probably benign Het
Pisd G A 5: 32,922,140 (GRCm39) P267S possibly damaging Het
Prm1 T A 16: 10,614,357 (GRCm39) probably benign Het
Ptprj A G 2: 90,293,439 (GRCm39) V548A probably damaging Het
Ranbp3 G A 17: 56,980,367 (GRCm39) probably benign Het
Raver2 T A 4: 100,960,009 (GRCm39) V163D probably damaging Het
Rbm14 A T 19: 4,853,905 (GRCm39) I159N possibly damaging Het
Rfx6 G A 10: 51,594,222 (GRCm39) V381I probably benign Het
Rhobtb1 T C 10: 69,108,693 (GRCm39) probably benign Het
Rpl28-ps4 T A 6: 117,190,856 (GRCm39) noncoding transcript Het
Rsph10b A G 5: 143,904,068 (GRCm39) probably null Het
Rspo4 A G 2: 151,715,013 (GRCm39) K217E unknown Het
Scgb2b27 G A 7: 33,712,710 (GRCm39) A44V possibly damaging Het
Sec14l2 G A 11: 4,061,435 (GRCm39) probably benign Het
Sec31b T C 19: 44,524,595 (GRCm39) N101D probably benign Het
Sema6a A T 18: 47,439,496 (GRCm39) C9* probably null Het
Septin5 A C 16: 18,441,762 (GRCm39) L331R probably benign Het
Slc16a11 C A 11: 70,106,477 (GRCm39) Y238* probably null Het
Slc25a12 T C 2: 71,142,892 (GRCm39) T210A probably benign Het
Slc35f1 A T 10: 52,965,443 (GRCm39) Y286F probably damaging Het
Szt2 A T 4: 118,233,645 (GRCm39) L2225* probably null Het
Thap12 T C 7: 98,365,827 (GRCm39) L665P probably damaging Het
Tpsb2 T A 17: 25,586,698 (GRCm39) W237R probably damaging Het
Tyk2 T C 9: 21,031,637 (GRCm39) D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 (GRCm39) N231K probably benign Het
Vmn1r225 A T 17: 20,722,852 (GRCm39) T98S possibly damaging Het
Vmn1r87 A T 7: 12,865,748 (GRCm39) S180T probably benign Het
Vmn2r6 A G 3: 64,445,262 (GRCm39) V821A probably damaging Het
Zfp689 C A 7: 127,043,998 (GRCm39) G211C probably damaging Het
Zfp827 A G 8: 79,802,865 (GRCm39) D479G probably benign Het
Zfp995 A C 17: 22,099,575 (GRCm39) F220V probably damaging Het
Other mutations in Lonrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Lonrf2 APN 1 38,851,616 (GRCm39) splice site probably benign
IGL02369:Lonrf2 APN 1 38,850,913 (GRCm39) splice site probably benign
IGL02526:Lonrf2 APN 1 38,839,791 (GRCm39) missense probably benign 0.02
gorged UTSW 1 38,843,417 (GRCm39) missense probably benign 0.05
Swollen UTSW 1 38,852,470 (GRCm39) missense probably benign
R1450:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1527:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1541:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1655:Lonrf2 UTSW 1 38,850,905 (GRCm39) missense probably damaging 0.98
R1679:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1681:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1711:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1732:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1758:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1768:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1795:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1831:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1832:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R1833:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R2054:Lonrf2 UTSW 1 38,852,357 (GRCm39) missense probably benign 0.14
R2656:Lonrf2 UTSW 1 38,855,041 (GRCm39) splice site probably null
R4084:Lonrf2 UTSW 1 38,860,232 (GRCm39) missense probably benign 0.00
R4775:Lonrf2 UTSW 1 38,857,140 (GRCm39) splice site probably null
R4796:Lonrf2 UTSW 1 38,855,119 (GRCm39) missense probably benign 0.00
R5445:Lonrf2 UTSW 1 38,846,234 (GRCm39) missense probably benign 0.05
R5875:Lonrf2 UTSW 1 38,846,128 (GRCm39) missense probably benign 0.01
R5902:Lonrf2 UTSW 1 38,846,174 (GRCm39) missense probably benign 0.17
R6441:Lonrf2 UTSW 1 38,857,204 (GRCm39) missense possibly damaging 0.76
R6533:Lonrf2 UTSW 1 38,852,349 (GRCm39) missense probably benign 0.08
R6695:Lonrf2 UTSW 1 38,852,470 (GRCm39) missense probably benign
R6930:Lonrf2 UTSW 1 38,843,417 (GRCm39) missense probably benign 0.05
R7923:Lonrf2 UTSW 1 38,839,843 (GRCm39) missense probably benign 0.30
R8237:Lonrf2 UTSW 1 38,839,854 (GRCm39) missense probably benign 0.00
R9072:Lonrf2 UTSW 1 38,850,867 (GRCm39) missense probably damaging 1.00
R9073:Lonrf2 UTSW 1 38,850,867 (GRCm39) missense probably damaging 1.00
R9433:Lonrf2 UTSW 1 38,875,538 (GRCm39) start gained probably benign
R9468:Lonrf2 UTSW 1 38,839,839 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTAGACCAGAGCTCTGTGC -3'
(R):5'- TTGCTTCTGCTCTGAACAGC -3'

Sequencing Primer
(F):5'- CCAGAGCTCTGTGCATAGATG -3'
(R):5'- GCTCTGAACAGCTTACACTTCTAAG -3'
Posted On 2014-08-25