Mutagenetix > Incidental Mutation

Incidental Mutation 'R2044:Col4a3'

221558

Institutional Source

Beutler Lab

Gene Symbol

Col4a3

Ensembl Gene

ENSMUSG00000079465

Gene Name

collagen, type IV, alpha 3

Synonyms

alpha3(IV), tumstatin

MMRRC Submission

040051-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82586921-82722059 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 82696319 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 1132 (G1132E)

Ref Sequence

ENSEMBL: ENSMUSP00000109084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113457]

AlphaFold

Q9QZS0

Predicted Effect

unknown
Transcript: ENSMUST00000113457
AA Change: G1132E

SMART Domains

Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: G1132E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Collagen	41	102	9.6e-11	PFAM
Pfam:Collagen	97	164	3.6e-11	PFAM
Pfam:Collagen	164	223	3.6e-9	PFAM
low complexity region	233	243	N/A	INTRINSIC
Pfam:Collagen	284	344	2.4e-10	PFAM
low complexity region	368	393	N/A	INTRINSIC
Pfam:Collagen	415	477	5e-10	PFAM
Pfam:Collagen	481	545	1e-9	PFAM
low complexity region	550	585	N/A	INTRINSIC
Pfam:Collagen	588	653	8.9e-9	PFAM
Pfam:Collagen	682	744	1.1e-8	PFAM
Pfam:Collagen	743	807	6.9e-10	PFAM
Pfam:Collagen	786	847	1.5e-8	PFAM
Pfam:Collagen	845	904	1.5e-10	PFAM
Pfam:Collagen	887	946	4.1e-10	PFAM
Pfam:Collagen	948	1006	8.1e-11	PFAM
Pfam:Collagen	997	1061	2.8e-10	PFAM
Pfam:Collagen	1057	1120	2.5e-10	PFAM
Pfam:Collagen	1114	1176	1.7e-9	PFAM
Pfam:Collagen	1174	1233	1.1e-9	PFAM
Pfam:Collagen	1232	1295	6.9e-9	PFAM
low complexity region	1326	1347	N/A	INTRINSIC
Pfam:Collagen	1377	1439	4.9e-11	PFAM
C4	1444	1553	3.77e-70	SMART
C4	1554	1667	3.28e-70	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181720

Meta Mutation Damage Score

0.9411

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,094		probably benign	Het
Abhd15	A	G	11: 77,518,338	T293A	probably benign	Het
Aldh1l1	C	T	6: 90,562,665	P192L	probably benign	Het
Aldoart1	T	G	4: 72,852,542	I10L	probably benign	Het
Ankhd1	G	A	18: 36,645,113	G1653D	probably benign	Het
Ankk1	A	C	9: 49,419,364		probably null	Het
Astn1	A	G	1: 158,600,502	T748A	possibly damaging	Het
Bmp7	C	A	2: 172,939,915	R52L	possibly damaging	Het
Ccdc151	T	G	9: 21,991,858	T419P	possibly damaging	Het
Ccdc33	G	A	9: 58,031,112	P859S	possibly damaging	Het
Ccny	A	G	18: 9,449,644	S10P	probably damaging	Het
Cdc6	C	A	11: 98,910,461	F179L	probably benign	Het
Cdc7	T	A	5: 106,983,132	V491E	probably benign	Het
Cdh23	G	T	10: 60,596,730	S138R	possibly damaging	Het
Cenpc1	T	C	5: 86,037,755	H299R	probably benign	Het
Ciart	A	T	3: 95,878,701	M354K	probably benign	Het
Clasrp	G	T	7: 19,586,715		probably benign	Het
Crebbp	G	A	16: 4,084,823	T2184I	probably benign	Het
Cyp2r1	A	C	7: 114,550,405	M458R	probably damaging	Het
Cyp7a1	C	A	4: 6,275,492	R27M	probably null	Het
Ddhd2	A	G	8: 25,752,165	F116L	probably damaging	Het
Dgkd	G	A	1: 87,927,691	R685K	probably benign	Het
Dnah2	A	G	11: 69,524,240	S223P	probably benign	Het
Exph5	A	T	9: 53,372,679	R353S	possibly damaging	Het
F11	C	A	8: 45,252,118	V129F	probably benign	Het
F830045P16Rik	A	T	2: 129,459,397	S454T	possibly damaging	Het
Fam124a	T	C	14: 62,587,207	I50T	probably damaging	Het
Fam20c	T	C	5: 138,756,227		probably null	Het
Fam234b	A	G	6: 135,226,914	T405A	probably benign	Het
Fbxo18	C	A	2: 11,762,970	V356L	possibly damaging	Het
Flywch1	G	A	17: 23,762,313	Q132*	probably null	Het
Foxo6	T	C	4: 120,286,969	D95G	probably benign	Het
Ggt5	T	C	10: 75,604,087	F174S	probably damaging	Het
Gm7104	G	A	12: 88,285,781		noncoding transcript	Het
Gpr155	A	G	2: 73,373,633	L279P	probably damaging	Het
H2-T23	A	G	17: 36,032,191	L98P	probably damaging	Het
Heatr5a	A	G	12: 51,955,403	V250A	probably benign	Het
Heyl	A	T	4: 123,241,363	I50F	probably damaging	Het
Hist4h4	G	C	6: 136,804,103	R93G	possibly damaging	Het
Ifitm10	A	T	7: 142,356,034	S179R	probably damaging	Het
Isg15	A	T	4: 156,199,792	I93N	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga10	G	A	3: 96,657,690	V985I	probably benign	Het
Kcnt2	T	C	1: 140,375,154	I144T	probably benign	Het
Klk1	A	C	7: 44,229,034	K104T	possibly damaging	Het
Lemd3	C	A	10: 120,933,442	R654L	probably damaging	Het
Lmod1	A	T	1: 135,364,387	M327L	probably benign	Het
Lonrf2	T	C	1: 38,807,050	E347G	probably benign	Het
Ltbp1	A	G	17: 75,276,432	Y409C	probably damaging	Het
Mecom	A	T	3: 29,980,592	Y312N	probably damaging	Het
Mrgprb3	C	T	7: 48,643,734	C23Y	possibly damaging	Het
Mut	A	G	17: 40,941,451	T295A	probably benign	Het
Nadk	C	A	4: 155,585,441	L194I	probably damaging	Het
Naxd	A	G	8: 11,509,510	I182V	probably benign	Het
Nbeal1	T	A	1: 60,319,687	I1176K	probably damaging	Het
Nol4l	C	A	2: 153,529,521	R81L	possibly damaging	Het
Olfr1297	T	A	2: 111,621,814	R87W	probably benign	Het
Olfr1411	G	T	1: 92,596,969	R150L	probably benign	Het
Olfr957	A	T	9: 39,511,378	M114K	probably damaging	Het
Pcdh18	A	G	3: 49,754,940	V642A	probably benign	Het
Pdzk1	G	A	3: 96,855,848		probably benign	Het
Per3	C	T	4: 151,033,938	V233I	probably benign	Het
Pisd	G	A	5: 32,764,796	P267S	possibly damaging	Het
Prm1	T	A	16: 10,796,493		probably benign	Het
Ptprj	A	G	2: 90,463,095	V548A	probably damaging	Het
Ranbp3	G	A	17: 56,673,367		probably benign	Het
Raver2	T	A	4: 101,102,812	V163D	probably damaging	Het
Rbm14	A	T	19: 4,803,877	I159N	possibly damaging	Het
Rfx6	G	A	10: 51,718,126	V381I	probably benign	Het
Rhobtb1	T	C	10: 69,272,863		probably benign	Het
Rpl28-ps4	T	A	6: 117,213,895		noncoding transcript	Het
Rsph10b	A	G	5: 143,967,250		probably null	Het
Rspo4	A	G	2: 151,873,093	K217E	unknown	Het
Scgb2b27	G	A	7: 34,013,285	A44V	possibly damaging	Het
Sec14l2	G	A	11: 4,111,435		probably benign	Het
Sec31b	T	C	19: 44,536,156	N101D	probably benign	Het
Sema6a	A	T	18: 47,306,429	C9*	probably null	Het
Sept5	A	C	16: 18,623,012	L331R	probably benign	Het
Slc16a11	C	A	11: 70,215,651	Y238*	probably null	Het
Slc25a12	T	C	2: 71,312,548	T210A	probably benign	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Szt2	A	T	4: 118,376,448	L2225*	probably null	Het
Thap12	T	C	7: 98,716,620	L665P	probably damaging	Het
Tpsb2	T	A	17: 25,367,724	W237R	probably damaging	Het
Tyk2	T	C	9: 21,120,341	D451G	probably damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Vmn1r225	A	T	17: 20,502,590	T98S	possibly damaging	Het
Vmn1r87	A	T	7: 13,131,821	S180T	probably benign	Het
Vmn2r6	A	G	3: 64,537,841	V821A	probably damaging	Het
Zfp689	C	A	7: 127,444,826	G211C	probably damaging	Het
Zfp827	A	G	8: 79,076,236	D479G	probably benign	Het
Zfp995	A	C	17: 21,880,594	F220V	probably damaging	Het

Other mutations in Col4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Col4a3	APN	1	82697754	missense	unknown
IGL00847:Col4a3	APN	1	82717869	missense	probably damaging	1.00
IGL01011:Col4a3	APN	1	82682301	missense	unknown
IGL01102:Col4a3	APN	1	82669720	missense	unknown
IGL01102:Col4a3	APN	1	82670255	missense	unknown
IGL02071:Col4a3	APN	1	82660887	critical splice donor site	probably null
IGL02244:Col4a3	APN	1	82669771	splice site	probably benign
IGL02380:Col4a3	APN	1	82672788	splice site	probably benign
IGL02431:Col4a3	APN	1	82679623	nonsense	probably null
IGL02466:Col4a3	APN	1	82670192	missense	unknown
IGL02694:Col4a3	APN	1	82710794	unclassified	probably benign
IGL02709:Col4a3	APN	1	82679112	missense	unknown
IGL02752:Col4a3	APN	1	82660225	missense	unknown
IGL02792:Col4a3	APN	1	82718803	missense	probably damaging	1.00
IGL03203:Col4a3	APN	1	82672639	nonsense	probably null
IGL03218:Col4a3	APN	1	82643206	splice site	probably benign
FR4976:Col4a3	UTSW	1	82718906	frame shift	probably null
PIT4260001:Col4a3	UTSW	1	82682761	missense	unknown
PIT4515001:Col4a3	UTSW	1	82682303	missense	unknown
R0035:Col4a3	UTSW	1	82672753	missense	unknown
R0099:Col4a3	UTSW	1	82717993	missense	probably benign	0.41
R0433:Col4a3	UTSW	1	82670219	missense	unknown
R0573:Col4a3	UTSW	1	82716363	missense	possibly damaging	0.83
R0606:Col4a3	UTSW	1	82672586	splice site	probably benign
R0715:Col4a3	UTSW	1	82652158	splice site	probably benign
R0961:Col4a3	UTSW	1	82708576	splice site	probably benign
R1257:Col4a3	UTSW	1	82716365	missense	probably damaging	1.00
R1264:Col4a3	UTSW	1	82643301	splice site	probably benign
R1373:Col4a3	UTSW	1	82690087	splice site	probably benign
R1694:Col4a3	UTSW	1	82690663	splice site	probably null
R1895:Col4a3	UTSW	1	82679108	missense	unknown
R1925:Col4a3	UTSW	1	82700373	missense	unknown
R1925:Col4a3	UTSW	1	82711874	unclassified	probably benign
R2033:Col4a3	UTSW	1	82718011	intron	probably benign
R2122:Col4a3	UTSW	1	82654957	missense	unknown
R2282:Col4a3	UTSW	1	82708638	missense	unknown
R2318:Col4a3	UTSW	1	82648569	splice site	probably null
R2421:Col4a3	UTSW	1	82670275	splice site	probably benign
R2517:Col4a3	UTSW	1	82680710	missense	unknown
R2965:Col4a3	UTSW	1	82648600	missense	unknown
R3085:Col4a3	UTSW	1	82651258	missense	unknown
R3150:Col4a3	UTSW	1	82657137	splice site	probably null
R3947:Col4a3	UTSW	1	82715332	missense	probably damaging	1.00
R4756:Col4a3	UTSW	1	82716297	critical splice acceptor site	probably null
R4910:Col4a3	UTSW	1	82672679	missense	unknown
R4928:Col4a3	UTSW	1	82710977	unclassified	probably benign
R5044:Col4a3	UTSW	1	82666546	missense	unknown
R5557:Col4a3	UTSW	1	82715247	unclassified	probably benign
R5761:Col4a3	UTSW	1	82716057	nonsense	probably null
R5970:Col4a3	UTSW	1	82716329	missense	possibly damaging	0.76
R6576:Col4a3	UTSW	1	82708574	splice site	probably null
R6583:Col4a3	UTSW	1	82641476	missense	unknown
R6675:Col4a3	UTSW	1	82668925	missense	unknown
R7170:Col4a3	UTSW	1	82715909	splice site	probably null
R7592:Col4a3	UTSW	1	82648617	missense	unknown
R7624:Col4a3	UTSW	1	82718884	missense	probably benign
R7994:Col4a3	UTSW	1	82662906	missense	unknown
R8127:Col4a3	UTSW	1	82649760	missense	unknown
R8702:Col4a3	UTSW	1	82710979	missense	unknown
R8865:Col4a3	UTSW	1	82669762	critical splice donor site	probably null
R8973:Col4a3	UTSW	1	82715331	missense	probably benign	0.11
R9611:Col4a3	UTSW	1	82700297	missense	unknown
R9665:Col4a3	UTSW	1	82690580	missense	unknown
R9765:Col4a3	UTSW	1	82668957	nonsense	probably null
X0067:Col4a3	UTSW	1	82716159	missense	probably damaging	0.99
Z1177:Col4a3	UTSW	1	82690039	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGTTTCCAGGAGAATGCTTTTCAG -3'
(R):5'- TCCTGAGATGACCATGATACTGAC -3'

Sequencing Primer
(F):5'- AGGTGACCTGTCAGGAATTTCC -3'
(R):5'- CTGACAGATACTTCAATTAGGGAGTG -3'

Posted On

2014-08-25