Mutagenetix > Incidental Mutation

Incidental Mutation 'R2044:Kcnt2'

221566

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

040051-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R2044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140375154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 144 (I144T)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably benign
Transcript: ENSMUST00000060201
AA Change: I144T

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000054623
Gene: ENSMUSG00000052726
AA Change: I144T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	424	533	1.3e-31	PFAM
low complexity region	655	670	N/A	INTRINSIC
low complexity region	677	689	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119786
AA Change: I144T

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: I144T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120709
AA Change: I144T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: I144T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120796
AA Change: I144T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: I144T

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Meta Mutation Damage Score

0.1221

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

98% (92/94)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,094		probably benign	Het
Abhd15	A	G	11: 77,518,338	T293A	probably benign	Het
Aldh1l1	C	T	6: 90,562,665	P192L	probably benign	Het
Aldoart1	T	G	4: 72,852,542	I10L	probably benign	Het
Ankhd1	G	A	18: 36,645,113	G1653D	probably benign	Het
Ankk1	A	C	9: 49,419,364		probably null	Het
Astn1	A	G	1: 158,600,502	T748A	possibly damaging	Het
Bmp7	C	A	2: 172,939,915	R52L	possibly damaging	Het
Ccdc151	T	G	9: 21,991,858	T419P	possibly damaging	Het
Ccdc33	G	A	9: 58,031,112	P859S	possibly damaging	Het
Ccny	A	G	18: 9,449,644	S10P	probably damaging	Het
Cdc6	C	A	11: 98,910,461	F179L	probably benign	Het
Cdc7	T	A	5: 106,983,132	V491E	probably benign	Het
Cdh23	G	T	10: 60,596,730	S138R	possibly damaging	Het
Cenpc1	T	C	5: 86,037,755	H299R	probably benign	Het
Ciart	A	T	3: 95,878,701	M354K	probably benign	Het
Clasrp	G	T	7: 19,586,715		probably benign	Het
Col4a3	G	A	1: 82,696,319	G1132E	unknown	Het
Crebbp	G	A	16: 4,084,823	T2184I	probably benign	Het
Cyp2r1	A	C	7: 114,550,405	M458R	probably damaging	Het
Cyp7a1	C	A	4: 6,275,492	R27M	probably null	Het
Ddhd2	A	G	8: 25,752,165	F116L	probably damaging	Het
Dgkd	G	A	1: 87,927,691	R685K	probably benign	Het
Dnah2	A	G	11: 69,524,240	S223P	probably benign	Het
Exph5	A	T	9: 53,372,679	R353S	possibly damaging	Het
F11	C	A	8: 45,252,118	V129F	probably benign	Het
F830045P16Rik	A	T	2: 129,459,397	S454T	possibly damaging	Het
Fam124a	T	C	14: 62,587,207	I50T	probably damaging	Het
Fam20c	T	C	5: 138,756,227		probably null	Het
Fam234b	A	G	6: 135,226,914	T405A	probably benign	Het
Fbxo18	C	A	2: 11,762,970	V356L	possibly damaging	Het
Flywch1	G	A	17: 23,762,313	Q132*	probably null	Het
Foxo6	T	C	4: 120,286,969	D95G	probably benign	Het
Ggt5	T	C	10: 75,604,087	F174S	probably damaging	Het
Gm7104	G	A	12: 88,285,781		noncoding transcript	Het
Gpr155	A	G	2: 73,373,633	L279P	probably damaging	Het
H2-T23	A	G	17: 36,032,191	L98P	probably damaging	Het
Heatr5a	A	G	12: 51,955,403	V250A	probably benign	Het
Heyl	A	T	4: 123,241,363	I50F	probably damaging	Het
Hist4h4	G	C	6: 136,804,103	R93G	possibly damaging	Het
Ifitm10	A	T	7: 142,356,034	S179R	probably damaging	Het
Isg15	A	T	4: 156,199,792	I93N	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga10	G	A	3: 96,657,690	V985I	probably benign	Het
Klk1	A	C	7: 44,229,034	K104T	possibly damaging	Het
Lemd3	C	A	10: 120,933,442	R654L	probably damaging	Het
Lmod1	A	T	1: 135,364,387	M327L	probably benign	Het
Lonrf2	T	C	1: 38,807,050	E347G	probably benign	Het
Ltbp1	A	G	17: 75,276,432	Y409C	probably damaging	Het
Mecom	A	T	3: 29,980,592	Y312N	probably damaging	Het
Mrgprb3	C	T	7: 48,643,734	C23Y	possibly damaging	Het
Mut	A	G	17: 40,941,451	T295A	probably benign	Het
Nadk	C	A	4: 155,585,441	L194I	probably damaging	Het
Naxd	A	G	8: 11,509,510	I182V	probably benign	Het
Nbeal1	T	A	1: 60,319,687	I1176K	probably damaging	Het
Nol4l	C	A	2: 153,529,521	R81L	possibly damaging	Het
Olfr1297	T	A	2: 111,621,814	R87W	probably benign	Het
Olfr1411	G	T	1: 92,596,969	R150L	probably benign	Het
Olfr957	A	T	9: 39,511,378	M114K	probably damaging	Het
Pcdh18	A	G	3: 49,754,940	V642A	probably benign	Het
Pdzk1	G	A	3: 96,855,848		probably benign	Het
Per3	C	T	4: 151,033,938	V233I	probably benign	Het
Pisd	G	A	5: 32,764,796	P267S	possibly damaging	Het
Prm1	T	A	16: 10,796,493		probably benign	Het
Ptprj	A	G	2: 90,463,095	V548A	probably damaging	Het
Ranbp3	G	A	17: 56,673,367		probably benign	Het
Raver2	T	A	4: 101,102,812	V163D	probably damaging	Het
Rbm14	A	T	19: 4,803,877	I159N	possibly damaging	Het
Rfx6	G	A	10: 51,718,126	V381I	probably benign	Het
Rhobtb1	T	C	10: 69,272,863		probably benign	Het
Rpl28-ps4	T	A	6: 117,213,895		noncoding transcript	Het
Rsph10b	A	G	5: 143,967,250		probably null	Het
Rspo4	A	G	2: 151,873,093	K217E	unknown	Het
Scgb2b27	G	A	7: 34,013,285	A44V	possibly damaging	Het
Sec14l2	G	A	11: 4,111,435		probably benign	Het
Sec31b	T	C	19: 44,536,156	N101D	probably benign	Het
Sema6a	A	T	18: 47,306,429	C9*	probably null	Het
Sept5	A	C	16: 18,623,012	L331R	probably benign	Het
Slc16a11	C	A	11: 70,215,651	Y238*	probably null	Het
Slc25a12	T	C	2: 71,312,548	T210A	probably benign	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Szt2	A	T	4: 118,376,448	L2225*	probably null	Het
Thap12	T	C	7: 98,716,620	L665P	probably damaging	Het
Tpsb2	T	A	17: 25,367,724	W237R	probably damaging	Het
Tyk2	T	C	9: 21,120,341	D451G	probably damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Vmn1r225	A	T	17: 20,502,590	T98S	possibly damaging	Het
Vmn1r87	A	T	7: 13,131,821	S180T	probably benign	Het
Vmn2r6	A	G	3: 64,537,841	V821A	probably damaging	Het
Zfp689	C	A	7: 127,444,826	G211C	probably damaging	Het
Zfp827	A	G	8: 79,076,236	D479G	probably benign	Het
Zfp995	A	C	17: 21,880,594	F220V	probably damaging	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- ACACTATGTCTGGTCTACTTTGG -3'
(R):5'- GATACCTCTGCGCTGTATAATTCTC -3'

Sequencing Primer
(F):5'- ATGTCTGGTCTACTTTGGATACTTAC -3'
(R):5'- CTGCGCTGTATAATTCTCTAGTAGG -3'

Posted On

2014-08-25