Incidental Mutation 'R2044:Slc25a12'
ID221572
Institutional Source Beutler Lab
Gene Symbol Slc25a12
Ensembl Gene ENSMUSG00000027010
Gene Namesolute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R2044 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location71271063-71367749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71312548 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 210 (T210A)
Ref Sequence ENSEMBL: ENSMUSP00000122103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151937] [ENSMUST00000184169]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137916
Predicted Effect probably benign
Transcript: ENSMUST00000151937
AA Change: T210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122103
Gene: ENSMUSG00000027010
AA Change: T210A

DomainStartEndE-ValueType
EFh 56 84 1.83e1 SMART
EFh 90 118 5.8e-1 SMART
EFh 161 189 2.49e0 SMART
Pfam:Mito_carr 324 421 3e-27 PFAM
Pfam:Mito_carr 422 513 2.9e-18 PFAM
Pfam:Mito_carr 515 609 2.1e-27 PFAM
low complexity region 662 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184169
SMART Domains Protein: ENSMUSP00000139371
Gene: ENSMUSG00000027010

DomainStartEndE-ValueType
SCOP:d1irja_ 3 71 5e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding mitochondrial carrier protein. The encoded protein localizes to the mitochondria and is involved in the exchange of aspartate for glutamate across the inner mitochondrial membrane. Polymorphisms in this gene may be associated with autism, and mutations in this gene may also be a cause of global cerebral hypomyelination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele show severe growth defects, generalized tremors, postnatal lethality, impaired motor coordination, and CNS dysmyelination associated with decreased synthesis of myelin lipids and a striking reduction in brain aspartate and N-acetylaspartate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Slc25a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Slc25a12 APN 2 71344032 missense possibly damaging 0.63
IGL01116:Slc25a12 APN 2 71293352 splice site probably benign
IGL01375:Slc25a12 APN 2 71308050 splice site probably benign
IGL02631:Slc25a12 APN 2 71296742 missense possibly damaging 0.90
IGL02899:Slc25a12 APN 2 71279635 missense probably damaging 1.00
R0031:Slc25a12 UTSW 2 71333614 missense possibly damaging 0.93
R0689:Slc25a12 UTSW 2 71311493 missense possibly damaging 0.95
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1832:Slc25a12 UTSW 2 71333710 missense possibly damaging 0.85
R4537:Slc25a12 UTSW 2 71275106 utr 3 prime probably benign
R4668:Slc25a12 UTSW 2 71315062 missense probably benign 0.22
R4830:Slc25a12 UTSW 2 71296805 missense probably damaging 1.00
R5476:Slc25a12 UTSW 2 71275322 missense probably benign
R5698:Slc25a12 UTSW 2 71282573 missense probably damaging 1.00
R6074:Slc25a12 UTSW 2 71276454 missense probably benign 0.01
R6516:Slc25a12 UTSW 2 71324083 missense probably damaging 0.97
R7270:Slc25a12 UTSW 2 71324025 missense probably benign
R7794:Slc25a12 UTSW 2 71311508 missense probably damaging 1.00
R8022:Slc25a12 UTSW 2 71275189
Z1176:Slc25a12 UTSW 2 71296746
Predicted Primers PCR Primer
(F):5'- GTCTGATCAAAAGCATGGACTC -3'
(R):5'- ACATTGCGTAACCTCCCCTAAG -3'

Sequencing Primer
(F):5'- CATGGACTCGAGGATTCCAATTGAC -3'
(R):5'- GCACTGTGTTTTAGTCAGATAGCCC -3'
Posted On2014-08-25