Incidental Mutation 'R1975:Rbl2'
ID221583
Institutional Source Beutler Lab
Gene Symbol Rbl2
Ensembl Gene ENSMUSG00000031666
Gene NameRB transcriptional corepressor like 2
Synonymsp130, Rb2
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location91070057-91123844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91085462 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000147579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000209518] [ENSMUST00000211136]
Predicted Effect probably benign
Transcript: ENSMUST00000034091
AA Change: S263P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666
AA Change: S263P

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209518
AA Change: S263P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211136
AA Change: S220P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1924 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype PHENOTYPE: Nullizygous mice generally show no overt phenotype. Homozygotes for a null allele show strain-dependent embryonic lethality and growth arrest associated with altered apoptosis and cell proliferation, impaired neurogenesis and myogenesis, failed embryo turning and heart looping, and thin myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Rbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rbl2 APN 8 91085445 missense probably damaging 1.00
IGL01084:Rbl2 APN 8 91122313 missense probably damaging 0.99
IGL01317:Rbl2 APN 8 91100057 missense probably damaging 1.00
IGL01637:Rbl2 APN 8 91106438 missense probably benign
IGL01843:Rbl2 APN 8 91090216 missense probably benign 0.11
IGL01884:Rbl2 APN 8 91096836 missense probably damaging 1.00
IGL02071:Rbl2 APN 8 91102198 missense probably damaging 1.00
IGL02588:Rbl2 APN 8 91087084 missense probably damaging 0.99
IGL03027:Rbl2 APN 8 91078906 missense possibly damaging 0.92
IGL03162:Rbl2 APN 8 91085702 missense probably benign 0.01
IGL03200:Rbl2 APN 8 91096767 missense probably benign 0.00
R0165:Rbl2 UTSW 8 91074176 missense probably damaging 1.00
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0317:Rbl2 UTSW 8 91087144 missense probably benign 0.00
R0539:Rbl2 UTSW 8 91112505 splice site probably benign
R1532:Rbl2 UTSW 8 91106417 missense probably benign 0.01
R1696:Rbl2 UTSW 8 91085724 missense probably benign 0.12
R1852:Rbl2 UTSW 8 91095563 missense possibly damaging 0.84
R1866:Rbl2 UTSW 8 91112529 missense probably benign 0.00
R2062:Rbl2 UTSW 8 91106739 missense probably damaging 1.00
R2180:Rbl2 UTSW 8 91090055 missense possibly damaging 0.51
R2423:Rbl2 UTSW 8 91087146 missense probably benign 0.34
R3109:Rbl2 UTSW 8 91102235 missense probably benign
R4356:Rbl2 UTSW 8 91107107 missense probably damaging 0.97
R4692:Rbl2 UTSW 8 91122419 missense probably damaging 1.00
R4707:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R4784:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R5084:Rbl2 UTSW 8 91115131 missense probably benign 0.43
R5432:Rbl2 UTSW 8 91102283 missense probably benign 0.01
R5493:Rbl2 UTSW 8 91115819 missense probably damaging 1.00
R5546:Rbl2 UTSW 8 91078932 missense probably benign 0.00
R5918:Rbl2 UTSW 8 91090130 missense probably benign 0.02
R6186:Rbl2 UTSW 8 91106730 missense probably damaging 1.00
R6257:Rbl2 UTSW 8 91115678 missense probably damaging 1.00
R6526:Rbl2 UTSW 8 91096839 missense probably benign 0.04
R6546:Rbl2 UTSW 8 91070370 missense probably benign
R6714:Rbl2 UTSW 8 91106787 missense possibly damaging 0.91
R7214:Rbl2 UTSW 8 91083429 critical splice donor site probably null
R7286:Rbl2 UTSW 8 91102294 nonsense probably null
R7290:Rbl2 UTSW 8 91115041 missense probably benign 0.33
R7315:Rbl2 UTSW 8 91076012 missense probably damaging 0.96
R7524:Rbl2 UTSW 8 91115193 missense probably benign
R8060:Rbl2 UTSW 8 91096869 critical splice donor site probably null
R8071:Rbl2 UTSW 8 91113989 missense probably damaging 1.00
R8154:Rbl2 UTSW 8 91107197 missense probably damaging 1.00
R8302:Rbl2 UTSW 8 91085445 missense probably damaging 1.00
R8344:Rbl2 UTSW 8 91115759 missense possibly damaging 0.89
R8724:Rbl2 UTSW 8 91115209 missense possibly damaging 0.54
R8822:Rbl2 UTSW 8 91106718 missense possibly damaging 0.95
X0023:Rbl2 UTSW 8 91090079 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGAAGCGTGTCCCTTTCTG -3'
(R):5'- GTCTTTACCCAGAAAACGTCCG -3'

Sequencing Primer
(F):5'- GGGATGTTGCATATCCATCTCTGAC -3'
(R):5'- TTTACCCAGAAAACGTCCGTATGTC -3'
Posted On2014-08-25