Mutagenetix > Incidental Mutation

Incidental Mutation 'R2044:Itga10'

221596

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

040051-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R2044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 96651738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

probably benign
Transcript: ENSMUST00000029744

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119365

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,094		probably benign	Het
Abhd15	A	G	11: 77,518,338	T293A	probably benign	Het
Aldh1l1	C	T	6: 90,562,665	P192L	probably benign	Het
Aldoart1	T	G	4: 72,852,542	I10L	probably benign	Het
Ankhd1	G	A	18: 36,645,113	G1653D	probably benign	Het
Ankk1	A	C	9: 49,419,364		probably null	Het
Astn1	A	G	1: 158,600,502	T748A	possibly damaging	Het
Bmp7	C	A	2: 172,939,915	R52L	possibly damaging	Het
Ccdc151	T	G	9: 21,991,858	T419P	possibly damaging	Het
Ccdc33	G	A	9: 58,031,112	P859S	possibly damaging	Het
Ccny	A	G	18: 9,449,644	S10P	probably damaging	Het
Cdc6	C	A	11: 98,910,461	F179L	probably benign	Het
Cdc7	T	A	5: 106,983,132	V491E	probably benign	Het
Cdh23	G	T	10: 60,596,730	S138R	possibly damaging	Het
Cenpc1	T	C	5: 86,037,755	H299R	probably benign	Het
Ciart	A	T	3: 95,878,701	M354K	probably benign	Het
Clasrp	G	T	7: 19,586,715		probably benign	Het
Col4a3	G	A	1: 82,696,319	G1132E	unknown	Het
Crebbp	G	A	16: 4,084,823	T2184I	probably benign	Het
Cyp2r1	A	C	7: 114,550,405	M458R	probably damaging	Het
Cyp7a1	C	A	4: 6,275,492	R27M	probably null	Het
Ddhd2	A	G	8: 25,752,165	F116L	probably damaging	Het
Dgkd	G	A	1: 87,927,691	R685K	probably benign	Het
Dnah2	A	G	11: 69,524,240	S223P	probably benign	Het
Exph5	A	T	9: 53,372,679	R353S	possibly damaging	Het
F11	C	A	8: 45,252,118	V129F	probably benign	Het
F830045P16Rik	A	T	2: 129,459,397	S454T	possibly damaging	Het
Fam124a	T	C	14: 62,587,207	I50T	probably damaging	Het
Fam20c	T	C	5: 138,756,227		probably null	Het
Fam234b	A	G	6: 135,226,914	T405A	probably benign	Het
Fbxo18	C	A	2: 11,762,970	V356L	possibly damaging	Het
Flywch1	G	A	17: 23,762,313	Q132*	probably null	Het
Foxo6	T	C	4: 120,286,969	D95G	probably benign	Het
Ggt5	T	C	10: 75,604,087	F174S	probably damaging	Het
Gm7104	G	A	12: 88,285,781		noncoding transcript	Het
Gpr155	A	G	2: 73,373,633	L279P	probably damaging	Het
H2-T23	A	G	17: 36,032,191	L98P	probably damaging	Het
Heatr5a	A	G	12: 51,955,403	V250A	probably benign	Het
Heyl	A	T	4: 123,241,363	I50F	probably damaging	Het
Hist4h4	G	C	6: 136,804,103	R93G	possibly damaging	Het
Ifitm10	A	T	7: 142,356,034	S179R	probably damaging	Het
Isg15	A	T	4: 156,199,792	I93N	probably benign	Het
Kcnt2	T	C	1: 140,375,154	I144T	probably benign	Het
Klk1	A	C	7: 44,229,034	K104T	possibly damaging	Het
Lemd3	C	A	10: 120,933,442	R654L	probably damaging	Het
Lmod1	A	T	1: 135,364,387	M327L	probably benign	Het
Lonrf2	T	C	1: 38,807,050	E347G	probably benign	Het
Ltbp1	A	G	17: 75,276,432	Y409C	probably damaging	Het
Mecom	A	T	3: 29,980,592	Y312N	probably damaging	Het
Mrgprb3	C	T	7: 48,643,734	C23Y	possibly damaging	Het
Mut	A	G	17: 40,941,451	T295A	probably benign	Het
Nadk	C	A	4: 155,585,441	L194I	probably damaging	Het
Naxd	A	G	8: 11,509,510	I182V	probably benign	Het
Nbeal1	T	A	1: 60,319,687	I1176K	probably damaging	Het
Nol4l	C	A	2: 153,529,521	R81L	possibly damaging	Het
Olfr1297	T	A	2: 111,621,814	R87W	probably benign	Het
Olfr1411	G	T	1: 92,596,969	R150L	probably benign	Het
Olfr957	A	T	9: 39,511,378	M114K	probably damaging	Het
Pcdh18	A	G	3: 49,754,940	V642A	probably benign	Het
Pdzk1	G	A	3: 96,855,848		probably benign	Het
Per3	C	T	4: 151,033,938	V233I	probably benign	Het
Pisd	G	A	5: 32,764,796	P267S	possibly damaging	Het
Prm1	T	A	16: 10,796,493		probably benign	Het
Ptprj	A	G	2: 90,463,095	V548A	probably damaging	Het
Ranbp3	G	A	17: 56,673,367		probably benign	Het
Raver2	T	A	4: 101,102,812	V163D	probably damaging	Het
Rbm14	A	T	19: 4,803,877	I159N	possibly damaging	Het
Rfx6	G	A	10: 51,718,126	V381I	probably benign	Het
Rhobtb1	T	C	10: 69,272,863		probably benign	Het
Rpl28-ps4	T	A	6: 117,213,895		noncoding transcript	Het
Rsph10b	A	G	5: 143,967,250		probably null	Het
Rspo4	A	G	2: 151,873,093	K217E	unknown	Het
Scgb2b27	G	A	7: 34,013,285	A44V	possibly damaging	Het
Sec14l2	G	A	11: 4,111,435		probably benign	Het
Sec31b	T	C	19: 44,536,156	N101D	probably benign	Het
Sema6a	A	T	18: 47,306,429	C9*	probably null	Het
Sept5	A	C	16: 18,623,012	L331R	probably benign	Het
Slc16a11	C	A	11: 70,215,651	Y238*	probably null	Het
Slc25a12	T	C	2: 71,312,548	T210A	probably benign	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Szt2	A	T	4: 118,376,448	L2225*	probably null	Het
Thap12	T	C	7: 98,716,620	L665P	probably damaging	Het
Tpsb2	T	A	17: 25,367,724	W237R	probably damaging	Het
Tyk2	T	C	9: 21,120,341	D451G	probably damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Vmn1r225	A	T	17: 20,502,590	T98S	possibly damaging	Het
Vmn1r87	A	T	7: 13,131,821	S180T	probably benign	Het
Vmn2r6	A	G	3: 64,537,841	V821A	probably damaging	Het
Zfp689	C	A	7: 127,444,826	G211C	probably damaging	Het
Zfp827	A	G	8: 79,076,236	D479G	probably benign	Het
Zfp995	A	C	17: 21,880,594	F220V	probably damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACAGGTTGGATAGACCCTGACC -3'
(R):5'- ACTCTCTGTGACTCACCCAG -3'

Sequencing Primer
(F):5'- GGATAGACCCTGACCCTCTC -3'
(R):5'- TCTCTGTGACTCACCCAGGTAGG -3'

Posted On

2014-08-25